ID: 1054660572

View in Genome Browser
Species Human (GRCh38)
Location 9:67699016-67699038
Sequence AACCCAAGTTGGGACAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054660572_1054660585 30 Left 1054660572 9:67699016-67699038 CCCTGCCTGTCCCAACTTGGGTT No data
Right 1054660585 9:67699069-67699091 TCTTTCACCTGGGCTTTCTCTGG No data
1054660572_1054660583 19 Left 1054660572 9:67699016-67699038 CCCTGCCTGTCCCAACTTGGGTT No data
Right 1054660583 9:67699058-67699080 CAGGCTCATAGTCTTTCACCTGG No data
1054660572_1054660584 20 Left 1054660572 9:67699016-67699038 CCCTGCCTGTCCCAACTTGGGTT No data
Right 1054660584 9:67699059-67699081 AGGCTCATAGTCTTTCACCTGGG No data
1054660572_1054660577 0 Left 1054660572 9:67699016-67699038 CCCTGCCTGTCCCAACTTGGGTT No data
Right 1054660577 9:67699039-67699061 CTACCCTGATCCCTTCCGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054660572 Original CRISPR AACCCAAGTTGGGACAGGCA GGG (reversed) Intergenic
No off target data available for this crispr