ID: 1054660576

View in Genome Browser
Species Human (GRCh38)
Location 9:67699027-67699049
Sequence GATCAGGGTAGAACCCAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054660576_1054660585 19 Left 1054660576 9:67699027-67699049 CCAACTTGGGTTCTACCCTGATC No data
Right 1054660585 9:67699069-67699091 TCTTTCACCTGGGCTTTCTCTGG No data
1054660576_1054660583 8 Left 1054660576 9:67699027-67699049 CCAACTTGGGTTCTACCCTGATC No data
Right 1054660583 9:67699058-67699080 CAGGCTCATAGTCTTTCACCTGG No data
1054660576_1054660586 20 Left 1054660576 9:67699027-67699049 CCAACTTGGGTTCTACCCTGATC No data
Right 1054660586 9:67699070-67699092 CTTTCACCTGGGCTTTCTCTGGG No data
1054660576_1054660584 9 Left 1054660576 9:67699027-67699049 CCAACTTGGGTTCTACCCTGATC No data
Right 1054660584 9:67699059-67699081 AGGCTCATAGTCTTTCACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054660576 Original CRISPR GATCAGGGTAGAACCCAAGT TGG (reversed) Intergenic
No off target data available for this crispr