ID: 1054660577

View in Genome Browser
Species Human (GRCh38)
Location 9:67699039-67699061
Sequence CTACCCTGATCCCTTCCGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054660566_1054660577 22 Left 1054660566 9:67698994-67699016 CCCTAAAGACTGGGACTGCCTCC No data
Right 1054660577 9:67699039-67699061 CTACCCTGATCCCTTCCGACAGG No data
1054660571_1054660577 1 Left 1054660571 9:67699015-67699037 CCCCTGCCTGTCCCAACTTGGGT No data
Right 1054660577 9:67699039-67699061 CTACCCTGATCCCTTCCGACAGG No data
1054660565_1054660577 23 Left 1054660565 9:67698993-67699015 CCCCTAAAGACTGGGACTGCCTC No data
Right 1054660577 9:67699039-67699061 CTACCCTGATCCCTTCCGACAGG No data
1054660564_1054660577 24 Left 1054660564 9:67698992-67699014 CCCCCTAAAGACTGGGACTGCCT No data
Right 1054660577 9:67699039-67699061 CTACCCTGATCCCTTCCGACAGG No data
1054660575_1054660577 -10 Left 1054660575 9:67699026-67699048 CCCAACTTGGGTTCTACCCTGAT No data
Right 1054660577 9:67699039-67699061 CTACCCTGATCCCTTCCGACAGG No data
1054660563_1054660577 25 Left 1054660563 9:67698991-67699013 CCCCCCTAAAGACTGGGACTGCC No data
Right 1054660577 9:67699039-67699061 CTACCCTGATCCCTTCCGACAGG No data
1054660574_1054660577 -5 Left 1054660574 9:67699021-67699043 CCTGTCCCAACTTGGGTTCTACC No data
Right 1054660577 9:67699039-67699061 CTACCCTGATCCCTTCCGACAGG No data
1054660567_1054660577 21 Left 1054660567 9:67698995-67699017 CCTAAAGACTGGGACTGCCTCCC No data
Right 1054660577 9:67699039-67699061 CTACCCTGATCCCTTCCGACAGG No data
1054660573_1054660577 -1 Left 1054660573 9:67699017-67699039 CCTGCCTGTCCCAACTTGGGTTC No data
Right 1054660577 9:67699039-67699061 CTACCCTGATCCCTTCCGACAGG No data
1054660568_1054660577 4 Left 1054660568 9:67699012-67699034 CCTCCCCTGCCTGTCCCAACTTG No data
Right 1054660577 9:67699039-67699061 CTACCCTGATCCCTTCCGACAGG No data
1054660572_1054660577 0 Left 1054660572 9:67699016-67699038 CCCTGCCTGTCCCAACTTGGGTT No data
Right 1054660577 9:67699039-67699061 CTACCCTGATCCCTTCCGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054660577 Original CRISPR CTACCCTGATCCCTTCCGAC AGG Intergenic
No off target data available for this crispr