ID: 1054660579

View in Genome Browser
Species Human (GRCh38)
Location 9:67699043-67699065
Sequence TGAGCCTGTCGGAAGGGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054660579_1054660586 4 Left 1054660579 9:67699043-67699065 CCTGATCCCTTCCGACAGGCTCA No data
Right 1054660586 9:67699070-67699092 CTTTCACCTGGGCTTTCTCTGGG No data
1054660579_1054660585 3 Left 1054660579 9:67699043-67699065 CCTGATCCCTTCCGACAGGCTCA No data
Right 1054660585 9:67699069-67699091 TCTTTCACCTGGGCTTTCTCTGG No data
1054660579_1054660583 -8 Left 1054660579 9:67699043-67699065 CCTGATCCCTTCCGACAGGCTCA No data
Right 1054660583 9:67699058-67699080 CAGGCTCATAGTCTTTCACCTGG No data
1054660579_1054660588 15 Left 1054660579 9:67699043-67699065 CCTGATCCCTTCCGACAGGCTCA No data
Right 1054660588 9:67699081-67699103 GCTTTCTCTGGGACTCACCTAGG No data
1054660579_1054660589 30 Left 1054660579 9:67699043-67699065 CCTGATCCCTTCCGACAGGCTCA No data
Right 1054660589 9:67699096-67699118 CACCTAGGAGTTCCCCAGTGTGG No data
1054660579_1054660584 -7 Left 1054660579 9:67699043-67699065 CCTGATCCCTTCCGACAGGCTCA No data
Right 1054660584 9:67699059-67699081 AGGCTCATAGTCTTTCACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054660579 Original CRISPR TGAGCCTGTCGGAAGGGATC AGG (reversed) Intergenic
No off target data available for this crispr