ID: 1054660581

View in Genome Browser
Species Human (GRCh38)
Location 9:67699050-67699072
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054660581_1054660589 23 Left 1054660581 9:67699050-67699072 CCTTCCGACAGGCTCATAGTCTT No data
Right 1054660589 9:67699096-67699118 CACCTAGGAGTTCCCCAGTGTGG No data
1054660581_1054660588 8 Left 1054660581 9:67699050-67699072 CCTTCCGACAGGCTCATAGTCTT No data
Right 1054660588 9:67699081-67699103 GCTTTCTCTGGGACTCACCTAGG No data
1054660581_1054660585 -4 Left 1054660581 9:67699050-67699072 CCTTCCGACAGGCTCATAGTCTT No data
Right 1054660585 9:67699069-67699091 TCTTTCACCTGGGCTTTCTCTGG No data
1054660581_1054660591 27 Left 1054660581 9:67699050-67699072 CCTTCCGACAGGCTCATAGTCTT No data
Right 1054660591 9:67699100-67699122 TAGGAGTTCCCCAGTGTGGTAGG No data
1054660581_1054660586 -3 Left 1054660581 9:67699050-67699072 CCTTCCGACAGGCTCATAGTCTT No data
Right 1054660586 9:67699070-67699092 CTTTCACCTGGGCTTTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054660581 Original CRISPR AAGACTATGAGCCTGTCGGA AGG (reversed) Intergenic
No off target data available for this crispr