ID: 1054660584

View in Genome Browser
Species Human (GRCh38)
Location 9:67699059-67699081
Sequence AGGCTCATAGTCTTTCACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054660578_1054660584 -6 Left 1054660578 9:67699042-67699064 CCCTGATCCCTTCCGACAGGCTC No data
Right 1054660584 9:67699059-67699081 AGGCTCATAGTCTTTCACCTGGG No data
1054660571_1054660584 21 Left 1054660571 9:67699015-67699037 CCCCTGCCTGTCCCAACTTGGGT No data
Right 1054660584 9:67699059-67699081 AGGCTCATAGTCTTTCACCTGGG No data
1054660574_1054660584 15 Left 1054660574 9:67699021-67699043 CCTGTCCCAACTTGGGTTCTACC No data
Right 1054660584 9:67699059-67699081 AGGCTCATAGTCTTTCACCTGGG No data
1054660575_1054660584 10 Left 1054660575 9:67699026-67699048 CCCAACTTGGGTTCTACCCTGAT No data
Right 1054660584 9:67699059-67699081 AGGCTCATAGTCTTTCACCTGGG No data
1054660572_1054660584 20 Left 1054660572 9:67699016-67699038 CCCTGCCTGTCCCAACTTGGGTT No data
Right 1054660584 9:67699059-67699081 AGGCTCATAGTCTTTCACCTGGG No data
1054660579_1054660584 -7 Left 1054660579 9:67699043-67699065 CCTGATCCCTTCCGACAGGCTCA No data
Right 1054660584 9:67699059-67699081 AGGCTCATAGTCTTTCACCTGGG No data
1054660576_1054660584 9 Left 1054660576 9:67699027-67699049 CCAACTTGGGTTCTACCCTGATC No data
Right 1054660584 9:67699059-67699081 AGGCTCATAGTCTTTCACCTGGG No data
1054660573_1054660584 19 Left 1054660573 9:67699017-67699039 CCTGCCTGTCCCAACTTGGGTTC No data
Right 1054660584 9:67699059-67699081 AGGCTCATAGTCTTTCACCTGGG No data
1054660568_1054660584 24 Left 1054660568 9:67699012-67699034 CCTCCCCTGCCTGTCCCAACTTG No data
Right 1054660584 9:67699059-67699081 AGGCTCATAGTCTTTCACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054660584 Original CRISPR AGGCTCATAGTCTTTCACCT GGG Intergenic
No off target data available for this crispr