ID: 1054660585

View in Genome Browser
Species Human (GRCh38)
Location 9:67699069-67699091
Sequence TCTTTCACCTGGGCTTTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054660576_1054660585 19 Left 1054660576 9:67699027-67699049 CCAACTTGGGTTCTACCCTGATC No data
Right 1054660585 9:67699069-67699091 TCTTTCACCTGGGCTTTCTCTGG No data
1054660573_1054660585 29 Left 1054660573 9:67699017-67699039 CCTGCCTGTCCCAACTTGGGTTC No data
Right 1054660585 9:67699069-67699091 TCTTTCACCTGGGCTTTCTCTGG No data
1054660575_1054660585 20 Left 1054660575 9:67699026-67699048 CCCAACTTGGGTTCTACCCTGAT No data
Right 1054660585 9:67699069-67699091 TCTTTCACCTGGGCTTTCTCTGG No data
1054660574_1054660585 25 Left 1054660574 9:67699021-67699043 CCTGTCCCAACTTGGGTTCTACC No data
Right 1054660585 9:67699069-67699091 TCTTTCACCTGGGCTTTCTCTGG No data
1054660582_1054660585 -8 Left 1054660582 9:67699054-67699076 CCGACAGGCTCATAGTCTTTCAC No data
Right 1054660585 9:67699069-67699091 TCTTTCACCTGGGCTTTCTCTGG No data
1054660581_1054660585 -4 Left 1054660581 9:67699050-67699072 CCTTCCGACAGGCTCATAGTCTT No data
Right 1054660585 9:67699069-67699091 TCTTTCACCTGGGCTTTCTCTGG No data
1054660578_1054660585 4 Left 1054660578 9:67699042-67699064 CCCTGATCCCTTCCGACAGGCTC No data
Right 1054660585 9:67699069-67699091 TCTTTCACCTGGGCTTTCTCTGG No data
1054660580_1054660585 -3 Left 1054660580 9:67699049-67699071 CCCTTCCGACAGGCTCATAGTCT No data
Right 1054660585 9:67699069-67699091 TCTTTCACCTGGGCTTTCTCTGG No data
1054660572_1054660585 30 Left 1054660572 9:67699016-67699038 CCCTGCCTGTCCCAACTTGGGTT No data
Right 1054660585 9:67699069-67699091 TCTTTCACCTGGGCTTTCTCTGG No data
1054660579_1054660585 3 Left 1054660579 9:67699043-67699065 CCTGATCCCTTCCGACAGGCTCA No data
Right 1054660585 9:67699069-67699091 TCTTTCACCTGGGCTTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054660585 Original CRISPR TCTTTCACCTGGGCTTTCTC TGG Intergenic
No off target data available for this crispr