ID: 1054660588

View in Genome Browser
Species Human (GRCh38)
Location 9:67699081-67699103
Sequence GCTTTCTCTGGGACTCACCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054660578_1054660588 16 Left 1054660578 9:67699042-67699064 CCCTGATCCCTTCCGACAGGCTC No data
Right 1054660588 9:67699081-67699103 GCTTTCTCTGGGACTCACCTAGG No data
1054660582_1054660588 4 Left 1054660582 9:67699054-67699076 CCGACAGGCTCATAGTCTTTCAC No data
Right 1054660588 9:67699081-67699103 GCTTTCTCTGGGACTCACCTAGG No data
1054660579_1054660588 15 Left 1054660579 9:67699043-67699065 CCTGATCCCTTCCGACAGGCTCA No data
Right 1054660588 9:67699081-67699103 GCTTTCTCTGGGACTCACCTAGG No data
1054660580_1054660588 9 Left 1054660580 9:67699049-67699071 CCCTTCCGACAGGCTCATAGTCT No data
Right 1054660588 9:67699081-67699103 GCTTTCTCTGGGACTCACCTAGG No data
1054660581_1054660588 8 Left 1054660581 9:67699050-67699072 CCTTCCGACAGGCTCATAGTCTT No data
Right 1054660588 9:67699081-67699103 GCTTTCTCTGGGACTCACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054660588 Original CRISPR GCTTTCTCTGGGACTCACCT AGG Intergenic
No off target data available for this crispr