ID: 1054660591

View in Genome Browser
Species Human (GRCh38)
Location 9:67699100-67699122
Sequence TAGGAGTTCCCCAGTGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054660587_1054660591 1 Left 1054660587 9:67699076-67699098 CCTGGGCTTTCTCTGGGACTCAC No data
Right 1054660591 9:67699100-67699122 TAGGAGTTCCCCAGTGTGGTAGG No data
1054660581_1054660591 27 Left 1054660581 9:67699050-67699072 CCTTCCGACAGGCTCATAGTCTT No data
Right 1054660591 9:67699100-67699122 TAGGAGTTCCCCAGTGTGGTAGG No data
1054660580_1054660591 28 Left 1054660580 9:67699049-67699071 CCCTTCCGACAGGCTCATAGTCT No data
Right 1054660591 9:67699100-67699122 TAGGAGTTCCCCAGTGTGGTAGG No data
1054660582_1054660591 23 Left 1054660582 9:67699054-67699076 CCGACAGGCTCATAGTCTTTCAC No data
Right 1054660591 9:67699100-67699122 TAGGAGTTCCCCAGTGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054660591 Original CRISPR TAGGAGTTCCCCAGTGTGGT AGG Intergenic
No off target data available for this crispr