ID: 1054662075

View in Genome Browser
Species Human (GRCh38)
Location 9:67708918-67708940
Sequence CTGGCTACACATTAGCAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054662071_1054662075 -1 Left 1054662071 9:67708896-67708918 CCTAGGGCCTGCATCTCAACCTC No data
Right 1054662075 9:67708918-67708940 CTGGCTACACATTAGCAACCTGG No data
1054662066_1054662075 21 Left 1054662066 9:67708874-67708896 CCCCTTATCTCTTGTATCATTTC No data
Right 1054662075 9:67708918-67708940 CTGGCTACACATTAGCAACCTGG No data
1054662065_1054662075 25 Left 1054662065 9:67708870-67708892 CCTTCCCCTTATCTCTTGTATCA No data
Right 1054662075 9:67708918-67708940 CTGGCTACACATTAGCAACCTGG No data
1054662068_1054662075 19 Left 1054662068 9:67708876-67708898 CCTTATCTCTTGTATCATTTCCT No data
Right 1054662075 9:67708918-67708940 CTGGCTACACATTAGCAACCTGG No data
1054662067_1054662075 20 Left 1054662067 9:67708875-67708897 CCCTTATCTCTTGTATCATTTCC No data
Right 1054662075 9:67708918-67708940 CTGGCTACACATTAGCAACCTGG No data
1054662073_1054662075 -8 Left 1054662073 9:67708903-67708925 CCTGCATCTCAACCTCTGGCTAC No data
Right 1054662075 9:67708918-67708940 CTGGCTACACATTAGCAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054662075 Original CRISPR CTGGCTACACATTAGCAACC TGG Intergenic
No off target data available for this crispr