ID: 1054676113

View in Genome Browser
Species Human (GRCh38)
Location 9:67857959-67857981
Sequence CAACCACTATGGCCCCTGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054676106_1054676113 2 Left 1054676106 9:67857934-67857956 CCCCATCCCAGTTCCACAGAGAA No data
Right 1054676113 9:67857959-67857981 CAACCACTATGGCCCCTGAGCGG No data
1054676109_1054676113 -4 Left 1054676109 9:67857940-67857962 CCCAGTTCCACAGAGAACTCAAC No data
Right 1054676113 9:67857959-67857981 CAACCACTATGGCCCCTGAGCGG No data
1054676104_1054676113 27 Left 1054676104 9:67857909-67857931 CCAAAGGACGGGAACTGGCCGTT No data
Right 1054676113 9:67857959-67857981 CAACCACTATGGCCCCTGAGCGG No data
1054676108_1054676113 0 Left 1054676108 9:67857936-67857958 CCATCCCAGTTCCACAGAGAACT No data
Right 1054676113 9:67857959-67857981 CAACCACTATGGCCCCTGAGCGG No data
1054676105_1054676113 9 Left 1054676105 9:67857927-67857949 CCGTTCACCCCATCCCAGTTCCA No data
Right 1054676113 9:67857959-67857981 CAACCACTATGGCCCCTGAGCGG No data
1054676110_1054676113 -5 Left 1054676110 9:67857941-67857963 CCAGTTCCACAGAGAACTCAACC No data
Right 1054676113 9:67857959-67857981 CAACCACTATGGCCCCTGAGCGG No data
1054676107_1054676113 1 Left 1054676107 9:67857935-67857957 CCCATCCCAGTTCCACAGAGAAC No data
Right 1054676113 9:67857959-67857981 CAACCACTATGGCCCCTGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054676113 Original CRISPR CAACCACTATGGCCCCTGAG CGG Intergenic
No off target data available for this crispr