ID: 1054681091

View in Genome Browser
Species Human (GRCh38)
Location 9:67919642-67919664
Sequence AGCGGTGTGTGGAAGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054681086_1054681091 21 Left 1054681086 9:67919598-67919620 CCTAAAACTTAAAGTATAAAAAA 0: 539
1: 5116
2: 18674
3: 12453
4: 9159
Right 1054681091 9:67919642-67919664 AGCGGTGTGTGGAAGGCAGAAGG No data
1054681085_1054681091 22 Left 1054681085 9:67919597-67919619 CCCTAAAACTTAAAGTATAAAAA 0: 580
1: 14598
2: 11716
3: 6052
4: 4796
Right 1054681091 9:67919642-67919664 AGCGGTGTGTGGAAGGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054681091 Original CRISPR AGCGGTGTGTGGAAGGCAGA AGG Intergenic
No off target data available for this crispr