ID: 1054690519

View in Genome Browser
Species Human (GRCh38)
Location 9:68318565-68318587
Sequence CTAAATATACAGCTTGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054690519_1054690522 -6 Left 1054690519 9:68318565-68318587 CCTTTTTCAAGCTGTATATTTAG No data
Right 1054690522 9:68318582-68318604 ATTTAGAACAATATCCCATGGGG No data
1054690519_1054690521 -7 Left 1054690519 9:68318565-68318587 CCTTTTTCAAGCTGTATATTTAG No data
Right 1054690521 9:68318581-68318603 TATTTAGAACAATATCCCATGGG No data
1054690519_1054690525 16 Left 1054690519 9:68318565-68318587 CCTTTTTCAAGCTGTATATTTAG No data
Right 1054690525 9:68318604-68318626 GCTGTACATGTCTTCGATACTGG No data
1054690519_1054690520 -8 Left 1054690519 9:68318565-68318587 CCTTTTTCAAGCTGTATATTTAG No data
Right 1054690520 9:68318580-68318602 ATATTTAGAACAATATCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054690519 Original CRISPR CTAAATATACAGCTTGAAAA AGG (reversed) Intergenic
No off target data available for this crispr