ID: 1054695302

View in Genome Browser
Species Human (GRCh38)
Location 9:68354869-68354891
Sequence GCGTGGTGGCATGTACCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054695297_1054695302 9 Left 1054695297 9:68354837-68354859 CCATGTCTACAAAAACTACAAAA 0: 7
1: 450
2: 14183
3: 231904
4: 143756
Right 1054695302 9:68354869-68354891 GCGTGGTGGCATGTACCTGTAGG No data
1054695296_1054695302 10 Left 1054695296 9:68354836-68354858 CCCATGTCTACAAAAACTACAAA 0: 6
1: 278
2: 8676
3: 119036
4: 271590
Right 1054695302 9:68354869-68354891 GCGTGGTGGCATGTACCTGTAGG No data
1054695295_1054695302 11 Left 1054695295 9:68354835-68354857 CCCCATGTCTACAAAAACTACAA 0: 6
1: 268
2: 7871
3: 107908
4: 196727
Right 1054695302 9:68354869-68354891 GCGTGGTGGCATGTACCTGTAGG No data
1054695294_1054695302 30 Left 1054695294 9:68354816-68354838 CCTAGGCAACATGGTGAAACCCC 0: 363
1: 8816
2: 91778
3: 182747
4: 226663
Right 1054695302 9:68354869-68354891 GCGTGGTGGCATGTACCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054695302 Original CRISPR GCGTGGTGGCATGTACCTGT AGG Intronic
No off target data available for this crispr