ID: 1054695582

View in Genome Browser
Species Human (GRCh38)
Location 9:68356858-68356880
Sequence CGGTCTGGCAGCGGAGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 4, 1: 0, 2: 0, 3: 6, 4: 155}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054695569_1054695582 22 Left 1054695569 9:68356813-68356835 CCCGAAAGTGAGTCCAACTTGGG 0: 3
1: 0
2: 1
3: 9
4: 92
Right 1054695582 9:68356858-68356880 CGGTCTGGCAGCGGAGAAGGTGG 0: 4
1: 0
2: 0
3: 6
4: 155
1054695567_1054695582 23 Left 1054695567 9:68356812-68356834 CCCCGAAAGTGAGTCCAACTTGG 0: 2
1: 0
2: 1
3: 0
4: 86
Right 1054695582 9:68356858-68356880 CGGTCTGGCAGCGGAGAAGGTGG 0: 4
1: 0
2: 0
3: 6
4: 155
1054695574_1054695582 9 Left 1054695574 9:68356826-68356848 CCAACTTGGGGAGAAACTGAGGG 0: 4
1: 0
2: 4
3: 44
4: 271
Right 1054695582 9:68356858-68356880 CGGTCTGGCAGCGGAGAAGGTGG 0: 4
1: 0
2: 0
3: 6
4: 155
1054695571_1054695582 21 Left 1054695571 9:68356814-68356836 CCGAAAGTGAGTCCAACTTGGGG 0: 3
1: 0
2: 2
3: 5
4: 85
Right 1054695582 9:68356858-68356880 CGGTCTGGCAGCGGAGAAGGTGG 0: 4
1: 0
2: 0
3: 6
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054695582 Original CRISPR CGGTCTGGCAGCGGAGAAGG TGG Intronic
903671709 1:25039846-25039868 AGGTCTGGCATGGGAGATGGAGG - Intergenic
903907300 1:26696201-26696223 CGGGCTGGCGGCGGCGGAGGAGG - Exonic
906746813 1:48228015-48228037 CTGACTGGGAGGGGAGAAGGGGG - Intronic
906762385 1:48387663-48387685 TGGTCTGGCATGGGAGGAGGAGG - Intronic
908130227 1:61067965-61067987 CTGTGTGGCAGTGGTGAAGGTGG + Intronic
909688488 1:78377898-78377920 CTGTCTGGCTGGGGAGTAGGAGG - Intronic
913201910 1:116501704-116501726 CGGTCTGGCTCCAGACAAGGTGG + Intergenic
915139873 1:153760808-153760830 TGATCTGGAAGCGAAGAAGGAGG - Exonic
916199917 1:162261166-162261188 TGGTCTGGCATCAGAGAATGAGG + Intronic
916721036 1:167484929-167484951 CAGTCTGGCAGCAGAGCAGCAGG - Intronic
918487625 1:185045809-185045831 CGCTCTCGCGGCGGAGACGGCGG + Intronic
919744562 1:201000389-201000411 AGGTCAGGCAGCGGAGGAAGAGG - Exonic
919826587 1:201507409-201507431 CTGTCTGTCAGGTGAGAAGGCGG + Exonic
919831007 1:201539938-201539960 GCGTCTGGGAGCGGAGAAAGTGG + Intergenic
923144861 1:231190746-231190768 CGGACTGGGAGCGGGGAAGCCGG + Intronic
923453111 1:234138358-234138380 CATTCTGGCAGAGGAGGAGGAGG + Intronic
924674883 1:246165713-246165735 AGGTCGGGGAGTGGAGAAGGTGG + Intronic
924680038 1:246221583-246221605 CCGTCTGGCACCGGGGAATGTGG - Intronic
1066421914 10:35271684-35271706 CACTCTGGCATCGGTGAAGGAGG - Intronic
1070817618 10:79335331-79335353 CAGTCTGGCAGCAGAGAGGCAGG + Intergenic
1072487752 10:95872705-95872727 CGGCCTGGCAGTGGACAGGGAGG - Exonic
1072540451 10:96394381-96394403 GGGCCTGACAGCAGAGAAGGAGG + Intronic
1073307318 10:102513595-102513617 CGGTCTGGGAGCAGAGCAGAGGG + Intronic
1074733798 10:116406727-116406749 TGGGCTGGCAGTGGAGAATGAGG - Intergenic
1075438738 10:122462899-122462921 TGTTCTGGCAGGGGAGACGGTGG + Intronic
1076035515 10:127196183-127196205 CGGGCCGGCAGCGGTGGAGGGGG - Intronic
1076301101 10:129426955-129426977 GGGTCTGGCAAAGGAGAAGCAGG + Intergenic
1079592040 11:22193008-22193030 CGGTCTGGAGGCGGGGAAAGAGG + Intergenic
1081861016 11:46333326-46333348 CGGCCGGGCAGCCGAGGAGGAGG + Intronic
1082009877 11:47442635-47442657 AGGTGGGGCAGCGGGGAAGGGGG - Exonic
1083000695 11:59288147-59288169 CGGTCTTGCAGAAGACAAGGAGG + Intergenic
1083293244 11:61701341-61701363 GGGCCTGGCAGCGGAGAGGCTGG - Intronic
1084176290 11:67424055-67424077 CGGGCTGGCACCAGAGCAGGAGG + Exonic
1085045037 11:73347769-73347791 CTGTCTGACAGCTGGGAAGGTGG + Intronic
1085259335 11:75195416-75195438 CTGTCTGGCAGAGGAGGAAGAGG + Intronic
1086322308 11:85664143-85664165 GGGTCTGGCAGCCGAGAACCAGG - Exonic
1086424761 11:86672353-86672375 CGGTCCCGCTGCGGAGCAGGCGG + Exonic
1090228556 11:125085853-125085875 TGGACTGGCAGTGGAGAAGGGGG - Intronic
1096148767 12:49295995-49296017 CGGACTGGGAGCTGAAAAGGGGG - Intronic
1101946523 12:109141397-109141419 GGGGATGGCAGAGGAGAAGGTGG - Intronic
1104090219 12:125510222-125510244 GGGTTTGGCAGCCGAGAAAGTGG + Intronic
1106351659 13:28936636-28936658 CTGTCTGGCAGCGTTGGAGGAGG + Intronic
1108392097 13:49956559-49956581 GGGACTGGAAGAGGAGAAGGAGG - Intergenic
1108413268 13:50172004-50172026 CGGCGTGACAGCGCAGAAGGGGG - Intronic
1110884536 13:80616869-80616891 GGGTATGGCCGAGGAGAAGGAGG + Intergenic
1112306550 13:98279917-98279939 GGGTCAGACAGCGGAGAACGTGG - Intronic
1114547536 14:23513555-23513577 GGGTCTGGGAGGGGAGAAGAGGG + Intergenic
1117899647 14:60518397-60518419 TGGGCTGGCACCTGAGAAGGTGG + Intergenic
1118354610 14:65002643-65002665 CGGGGTTGCAGCAGAGAAGGAGG + Intronic
1119423943 14:74524029-74524051 CAGAATGGCAGAGGAGAAGGGGG + Intronic
1120751481 14:88202659-88202681 CTGTCTGGAAGAGGAGAAAGTGG - Intronic
1120917088 14:89719763-89719785 GGGTCTAGGAGTGGAGAAGGGGG - Intergenic
1135322651 16:21507545-21507567 CTGTCTGTCGGTGGAGAAGGTGG - Intergenic
1135322685 16:21507675-21507697 CTGTCTGTCAGTGGAGATGGTGG - Intergenic
1135322691 16:21507701-21507723 CTGTCTATCAGTGGAGAAGGTGG - Intergenic
1135322697 16:21507727-21507749 CTGTCTATCAGTGGAGAAGGTGG - Intergenic
1136334128 16:29600682-29600704 CTGTCTATCAGTGGAGAAGGTGG - Intergenic
1136334141 16:29600734-29600756 CTGTCTGTCGGTGGAGAAGGTGG - Intergenic
1136334162 16:29600812-29600834 CTGTCTGTCAGTGGAGATGGTGG - Intergenic
1136334168 16:29600838-29600860 CTGTCTGTCGGTGGAGAAGGTGG - Intergenic
1136334186 16:29600916-29600938 CTGTCTATCAGTGGAGAAGGTGG - Intergenic
1137786240 16:51140064-51140086 CGCTCTGGCAGCTGAGAACCCGG + Exonic
1138561338 16:57802458-57802480 CGGGCTGGCCGAGGAGGAGGCGG - Exonic
1141734058 16:85840538-85840560 GGGTCTGGCAGAGGGGACGGAGG - Intergenic
1142034900 16:87856775-87856797 CTGTCTGTCGGTGGAGAAGGTGG - Intronic
1144692893 17:17280636-17280658 CCGCCTGGCAGCGGAGGAGCTGG + Intronic
1147053213 17:37813712-37813734 CAGTCTGGCTGCAGAGAAGCTGG - Intergenic
1148081161 17:44968282-44968304 CAGTCCGGCAGCGCAGCAGGAGG - Intergenic
1150656234 17:67041647-67041669 GGGCCTGGCTGCGGAGCAGGTGG - Intergenic
1154940941 18:21111932-21111954 CGGGCAGGCGGTGGAGAAGGCGG + Intergenic
1157473773 18:48008570-48008592 CGGGCCGGCGGCGGAGGAGGAGG - Intergenic
1158893286 18:61893044-61893066 AGGGCTGGCGGCCGAGAAGGGGG + Exonic
1159904587 18:74078139-74078161 TGATCTGGCAGCAGAGGAGGTGG - Intronic
1160888031 19:1361075-1361097 CAGTCTGGCTGCGGAGGAGCAGG - Intronic
1162918150 19:13885227-13885249 CTGTCTGGCAGGGGTGGAGGAGG - Intronic
1164897617 19:31890963-31890985 AGGTCTGGGAGTGGAGAAGTGGG + Intergenic
1166069867 19:40380790-40380812 CTGTCTGGCTGAGGAGAAGGAGG - Exonic
1166631173 19:44409413-44409435 CAGCCTGGCAGCGGAAAGGGCGG - Intergenic
1166632051 19:44415540-44415562 CAGCCTGGCAGCGGAAAGGGCGG - Intergenic
1166637000 19:44459168-44459190 CAGCCTGGCAGCGGAAAGGGCGG + Intergenic
1166745396 19:45139681-45139703 CAGTGTGGCAGCTGAGAGGGTGG + Intronic
1167591636 19:50407308-50407330 TGGCCTGGGAGGGGAGAAGGTGG - Exonic
1167637659 19:50664590-50664612 GGGACTGGAAGCTGAGAAGGTGG + Intronic
1167765344 19:51478819-51478841 GGGTCGGGGAGAGGAGAAGGGGG + Intronic
925032341 2:660759-660781 CGGCCTGGCTGAGGAGCAGGTGG - Intergenic
925886028 2:8394339-8394361 AGGTCAGGCAGGAGAGAAGGAGG + Intergenic
929133700 2:38602887-38602909 CGGGCAGGGAGCGGAGACGGAGG - Exonic
929452639 2:42047719-42047741 CCGTCTGGGAGCGGGGGAGGGGG - Intergenic
932297866 2:70641862-70641884 TGGGCTGGCAACGGCGAAGGCGG + Intronic
932751138 2:74372397-74372419 CTGTGGGGCAGGGGAGAAGGTGG + Intronic
932797893 2:74713455-74713477 CAGTCTGTCAGGGGAGAAAGAGG + Intergenic
933277677 2:80301296-80301318 TGGTCTGGCTGAGGGGAAGGAGG - Intronic
936561267 2:113541717-113541739 CGGTCTGGCAGCGGAGAAGGTGG + Intergenic
938221944 2:129576577-129576599 CAGTCTTGCAGAGGAGGAGGAGG - Intergenic
938541798 2:132289062-132289084 CAGCCTGGCAGCGGAAAGGGCGG + Intergenic
938794329 2:134705524-134705546 CCGTCAGGCATGGGAGAAGGTGG + Intronic
939826344 2:147020027-147020049 AGGTCTGACACCGAAGAAGGAGG + Intergenic
946065703 2:216985614-216985636 TGGTGTGGCAGAGGGGAAGGTGG + Intergenic
948542462 2:238700393-238700415 CGGTGTGGCACAGGAGAATGAGG + Intergenic
948828406 2:240585664-240585686 CGGTCAGGCAGGGGAGGAGAAGG - Intergenic
948828516 2:240586186-240586208 TCGTCAGGCAGGGGAGAAGGGGG - Intergenic
1168914543 20:1475504-1475526 CAGTCTGGCTGCCTAGAAGGTGG + Exonic
1171043375 20:21788020-21788042 AGGTGTGGCAGCGAAGAAAGGGG - Intergenic
1171346231 20:24468847-24468869 CGTTCTAGGAGCGGAGGAGGTGG - Intergenic
1171870673 20:30521943-30521965 CAGCCTGGCAGCGGAAAGGGCGG + Intergenic
1173920073 20:46737666-46737688 TAGTCTGGAAGGGGAGAAGGGGG + Intergenic
1175743108 20:61434696-61434718 CTGTGTGACAGCGGAGGAGGTGG - Intronic
1176116362 20:63433237-63433259 CCCTCGGGCAGCAGAGAAGGGGG - Intronic
1176236155 20:64054462-64054484 CAGCCTGGCAGGGGAGAAGGAGG - Intronic
1181561195 22:23702129-23702151 TGGTGTGGCAGCAGAGAAAGGGG + Intergenic
1182529502 22:30944461-30944483 AGGTCGGGGAGAGGAGAAGGGGG - Intronic
1183335624 22:37244333-37244355 CGGTCTGGCAGAGCAGCTGGTGG + Intronic
1184486575 22:44783444-44783466 CCCTCTGGCTGCAGAGAAGGGGG - Intronic
950136534 3:10585013-10585035 GGGTGTGGCAGGGGAGGAGGAGG - Intronic
953756190 3:45647817-45647839 CTGTGGGGCAGCGGAGGAGGGGG - Intronic
954297706 3:49683404-49683426 CGGTCTGGCAGGGCAGCAGGAGG + Exonic
969673165 4:8600985-8601007 CGGTCTGGCAGGGGAGGACCAGG - Intronic
971323171 4:25621801-25621823 AGGGCTGTCAGTGGAGAAGGCGG - Intergenic
981366678 4:143912182-143912204 CGGACAGGCAGCGGCGGAGGCGG - Intergenic
983904289 4:173168693-173168715 AGGGCAGGCAGCGGAGAGGGCGG + Intergenic
984611950 4:181851115-181851137 GGGTCTTGTAGTGGAGAAGGAGG - Intergenic
986733291 5:10650165-10650187 AGGGCTGGGCGCGGAGAAGGAGG + Exonic
988530530 5:32023308-32023330 CTGTCTGGGAGGGGAGACGGTGG - Intronic
995636728 5:114201680-114201702 GGGCCTGGCACCAGAGAAGGCGG + Intergenic
997584108 5:135034481-135034503 CGGTGTGTCACCGGGGAAGGAGG - Intronic
998038139 5:138933697-138933719 TGGTCTTGCAGAGGAGTAGGGGG + Intronic
999258377 5:150222474-150222496 CAGCCTGGCAGGGGAGAGGGTGG + Intronic
999858560 5:155620975-155620997 CAGTCTGGCAGCAGGGAGGGAGG + Intergenic
1001875259 5:175194820-175194842 TGGTCAGGCAGCCCAGAAGGAGG + Intergenic
1004660679 6:17706570-17706592 AGTGCTGGCAGCGGGGAAGGGGG + Exonic
1005634776 6:27743029-27743051 CTGTCTGTCATCGGAGCAGGTGG + Intergenic
1006077306 6:31542045-31542067 CGCTCTTGCAGCCAAGAAGGCGG - Exonic
1019323130 7:424608-424630 GGGGCTGGGAGGGGAGAAGGGGG + Intergenic
1019553686 7:1617929-1617951 CTGTCTGGAAGCTGAGGAGGAGG + Intergenic
1026651927 7:72223180-72223202 CGGTCAGGCAGAGGAGAAGAGGG + Intronic
1030259664 7:107549760-107549782 AGGTCTGACAGAGGAGAAGTGGG - Intronic
1030348167 7:108456089-108456111 CGGGCTGGCAGCGCTGCAGGAGG - Intronic
1034129011 7:148698852-148698874 CGGGCGGGCAGGGGAGGAGGAGG + Intronic
1034460519 7:151195601-151195623 CCGTCTGGCTGTGGACAAGGAGG - Exonic
1035453799 7:158996467-158996489 CGCCCTGGAAGCGGAGAAGCAGG - Intergenic
1035675579 8:1453258-1453280 CGGTCAGGCTGGGGAGAAGCAGG + Intergenic
1036557555 8:9873627-9873649 CAGCCTGGCAGCGGAGATGAGGG - Intergenic
1038643781 8:29347849-29347871 CGGTCTGGCTGGGGAAATGGAGG + Intronic
1044826945 8:96207850-96207872 CAGCGTGGCAGCAGAGAAGGTGG - Intergenic
1048298380 8:133233330-133233352 CAGCCTGGCAGCAGAGGAGGAGG + Intergenic
1049122846 8:140755417-140755439 CGGTGTGGCCGCGGAGTAGAGGG - Intronic
1049891425 9:73622-73644 CGGTCTGGCAGCGGAGAAGGTGG - Intergenic
1050377151 9:4985172-4985194 CGGTGTGGCCCCGGAGAGGGTGG + Intronic
1053732847 9:41074696-41074718 CGGTCTGGCAGCGGAGAAGGTGG - Intergenic
1054695582 9:68356858-68356880 CGGTCTGGCAGCGGAGAAGGTGG + Intronic
1055923892 9:81490259-81490281 CAGTCTCGAAGCTGAGAAGGAGG - Intergenic
1056900813 9:90597540-90597562 CAGTCCCGCAGCGGAGGAGGAGG + Intergenic
1057815399 9:98290483-98290505 GGCTCTGGCTGCGGAGAAGCTGG - Exonic
1059164904 9:112068318-112068340 AGGTCTGGCAGAGTAGAAGTAGG + Intronic
1060664627 9:125425395-125425417 CAGCCTGGAAGCCGAGAAGGGGG + Intergenic
1061209863 9:129184830-129184852 GAGTCTGGGAGCTGAGAAGGGGG - Intergenic
1061299924 9:129698368-129698390 CAGTCTGGCTGCAGAGAAGAGGG + Intronic
1061497537 9:130983546-130983568 CATTCTGCCAGCTGAGAAGGCGG + Intergenic
1061705544 9:132450374-132450396 GGGCCTGGCAGTGGAGAAGTTGG + Intronic
1062606887 9:137352429-137352451 GGATCTGGCAGCAGAGGAGGAGG + Intronic
1062652197 9:137583719-137583741 GGGTCTGGCTTCGGAGAACGGGG - Intronic
1185503840 X:618210-618232 GGGTCTGGCAGCGGGGAGGTGGG - Intergenic
1191597327 X:62959941-62959963 TGGTCTGGCAGGGGAGAGGGTGG - Intergenic
1192795264 X:74420812-74420834 CGGCCTGGGAGGGGAGGAGGCGG - Intergenic
1197750950 X:129963254-129963276 AGGCCTGCCACCGGAGAAGGGGG - Intergenic