ID: 1054696667

View in Genome Browser
Species Human (GRCh38)
Location 9:68367299-68367321
Sequence GGGTGGGCATGAAGGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1048
Summary {0: 1, 1: 3, 2: 6, 3: 92, 4: 946}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054696667_1054696681 24 Left 1054696667 9:68367299-68367321 CCCTCTCCCCTTCATGCCCACCC 0: 1
1: 3
2: 6
3: 92
4: 946
Right 1054696681 9:68367346-68367368 CTTAATCTGCTCATTTCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054696667 Original CRISPR GGGTGGGCATGAAGGGGAGA GGG (reversed) Intronic
900426776 1:2584095-2584117 GGGAGGACATGGAGGAGAGATGG - Intergenic
900512811 1:3068478-3068500 GGGTGGGGGCGAAGGGGAGGAGG + Intergenic
900527040 1:3134461-3134483 GGGAGGGCAGGAGGGGGTGATGG - Intronic
900544609 1:3221635-3221657 GGGCAGGCATTGAGGGGAGAAGG - Intronic
900894608 1:5474543-5474565 GCCTGGGCATGAGGGGGACAGGG - Intergenic
901052607 1:6432795-6432817 GGGTGGACATGGACGGGTGAAGG - Intronic
901167223 1:7229438-7229460 AGGGGGGTGTGAAGGGGAGAAGG + Intronic
901468283 1:9437697-9437719 GGTTGGGCTTGGAGGGGAGGAGG - Intergenic
901781751 1:11598908-11598930 GGGTGGGCATGGGGGCGACATGG + Intergenic
901938596 1:12645036-12645058 GGGAGGGAATGAAGGAGATAGGG - Intronic
902018492 1:13327668-13327690 GGCTCGGCATGAGAGGGAGAGGG - Intergenic
902209345 1:14893535-14893557 GGGTGTGGAGGAAGGGAAGATGG - Intronic
902481639 1:16715251-16715273 GGGTGGACATGGACGGGTGAAGG + Intergenic
902705951 1:18204578-18204600 GAGGGGAGATGAAGGGGAGAGGG + Intronic
902772176 1:18651806-18651828 GGGGGGGCGGGGAGGGGAGAGGG - Intronic
902828345 1:18992966-18992988 GGGTGGGCATGAATGGAAGAGGG - Intergenic
903135858 1:21308819-21308841 GGGCAGGCAGGAAGGGGAGGGGG - Intronic
903224023 1:21884966-21884988 GGGTGGGAATGAGGGGCAGCTGG - Intronic
903576527 1:24342803-24342825 CGGCTGGCGTGAAGGGGAGAAGG + Intronic
903638144 1:24834786-24834808 GGCTCGGCATGAGAGGGAGAGGG + Intronic
903761828 1:25703858-25703880 GGGTGGCCATGAAGGAAAGCAGG - Intronic
904013571 1:27404102-27404124 GGGTGGGCCTAAAGGGCAGGAGG - Intergenic
904250183 1:29217808-29217830 GTGTGGGCGTAATGGGGAGATGG + Intronic
904541002 1:31233288-31233310 GGGTGGGTAGAATGGGGAGAGGG + Intronic
905120587 1:35678830-35678852 GTGTGGGCCTGTAGGGGAGTGGG - Intergenic
905203037 1:36326651-36326673 CTGTGGGCAAGAAGGGGAGCAGG + Intronic
905309124 1:37037404-37037426 GGGAGGGGAGGAAGGGGGGAAGG - Intergenic
905404834 1:37725710-37725732 GGGTGGAGATGAAGGGGGGAAGG + Intronic
905478399 1:38244931-38244953 GGGTGGGCATGAGAGGGCGCAGG - Intergenic
906245566 1:44271081-44271103 TTGTGTGCATGAAGGGAAGAGGG - Intronic
906684964 1:47757374-47757396 GGCTGGGCTTGGAGGGGAGGAGG - Intergenic
907358467 1:53895562-53895584 GAGTGGGCAAGTCGGGGAGAAGG - Intronic
908149177 1:61282155-61282177 GGGCGGGCAGGAAGGGGAGAGGG - Intronic
908155655 1:61350049-61350071 GGGTAGGCATGGAGGTGAAAGGG - Intronic
908230928 1:62104135-62104157 GGGAGGGCGGGTAGGGGAGAAGG + Intronic
908574046 1:65440483-65440505 GTGTGGGCGTGAACGGGTGACGG + Intronic
909267323 1:73577253-73577275 TCCTGGGCATGAAGTGGAGATGG - Intergenic
909607623 1:77522594-77522616 GGGTGGGCAGGGAGGTGGGATGG - Intronic
910269418 1:85377697-85377719 GTGGGGGGATGAGGGGGAGAAGG - Intronic
911053956 1:93695139-93695161 GGGTGGGCAGGGAAGGAAGAAGG - Intronic
911273473 1:95831763-95831785 GGGGGTGAATGATGGGGAGAAGG + Intergenic
912261948 1:108119623-108119645 AGCTGGGCTTGAAGGGAAGAAGG - Intergenic
913326478 1:117632713-117632735 GGGAGGGGATGAAGGGCACAGGG - Intergenic
913397242 1:118385497-118385519 GGATGGGCATGTGGGGGAAAAGG + Intergenic
914243384 1:145867805-145867827 GGTTGTGCATGAATGTGAGAAGG - Intronic
915243598 1:154541272-154541294 GGGAGGGCAGGAGCGGGAGAGGG + Intronic
915525304 1:156472386-156472408 GGGTGCACATGCAAGGGAGAAGG + Intronic
915856197 1:159389003-159389025 AGGTGAGCTTGAAGGGAAGATGG + Intergenic
915956802 1:160227230-160227252 GGTTGGACATCAAGGAGAGAAGG + Intronic
916065415 1:161132348-161132370 AGGGGGGCGTGCAGGGGAGATGG - Intronic
916863989 1:168836784-168836806 GGCTGGGCATCAGAGGGAGACGG - Intergenic
917049320 1:170901034-170901056 GGGTGGGGGTGCAGGGGAGTGGG + Intergenic
917400384 1:174642743-174642765 GAGAGGGGAAGAAGGGGAGAGGG - Intronic
917672488 1:177286106-177286128 GTGTGGGGATGGAGGAGAGAAGG + Intergenic
917732708 1:177891965-177891987 GCCTGGGCATGAAGTGGAAAGGG - Intergenic
917790586 1:178496463-178496485 GGGTGAGCCTGAGGGGGAGAAGG - Intergenic
918031307 1:180814894-180814916 GGGTGGGGATGGAGTGTAGAAGG + Intronic
918181306 1:182087641-182087663 GGGTGTGCATGCAAGGGACAGGG + Intergenic
918813103 1:189146598-189146620 GGATGGGAAGGAAGGGGAGAAGG + Intergenic
918824223 1:189301034-189301056 GGGTGGGCCTGGAGGAAAGAAGG - Intergenic
919034507 1:192289300-192289322 GGGTGGGAATGAATAGGAGTTGG + Intergenic
919887627 1:201946383-201946405 TGGTGGGCAGGGAAGGGAGAGGG + Exonic
920010371 1:202862591-202862613 AAGTGGGGATGAAGAGGAGATGG - Intergenic
920054769 1:203183905-203183927 GGGAGGGCATGATTGGGACAGGG + Intronic
920184824 1:204152866-204152888 GGGTGGGAAGGAAGGGGAAGGGG + Intergenic
920500050 1:206480180-206480202 GAGTGGGCAGGAAGGGGAGATGG + Intronic
920500074 1:206480242-206480264 GGGTGGGCAGGAGAGGGAGGTGG + Intronic
920744819 1:208616761-208616783 GGGTGGGCGTGGTGGGGAGGTGG + Intergenic
921134537 1:212248523-212248545 GGATGGGAAGGAAGGGGAAAAGG + Intergenic
922003508 1:221504529-221504551 ACCTGGGCATGGAGGGGAGAGGG - Intergenic
922123103 1:222694430-222694452 GGGTTGGGATGAGGGAGAGAAGG + Intronic
922365476 1:224859581-224859603 GGCTGGGCATGTAGAGGGGAAGG - Intergenic
922505517 1:226123376-226123398 GGGAGGGCCTGGAGAGGAGAGGG - Intergenic
922780747 1:228250397-228250419 GGGTGTGCATGGGAGGGAGAGGG + Intronic
922782586 1:228264548-228264570 GGGTGTGCATGGGAGGGAGAGGG + Intronic
922799622 1:228359246-228359268 GGATGGACCTGGAGGGGAGACGG + Intronic
922801897 1:228368272-228368294 GGCTGGGCTTAAAGTGGAGAGGG + Intronic
922902490 1:229147728-229147750 AGGTGGGCAAGCGGGGGAGAGGG - Intergenic
922915751 1:229256227-229256249 AGGTGGGCAGGAAGGGGAGGTGG + Intergenic
923230693 1:231983587-231983609 GGGTGGGGCAGTAGGGGAGAGGG + Intronic
923421232 1:233817378-233817400 GGGTGGGCAAGTAAGAGAGAAGG + Intergenic
923457216 1:234174898-234174920 GGCAGGGAATGAAGGAGAGAAGG + Intronic
924328674 1:242921177-242921199 GGGAGGGAATGGAGGGGAGGAGG + Intergenic
924740950 1:246794025-246794047 GGGAGGGCAGGGTGGGGAGAAGG + Intergenic
1062878441 10:959758-959780 AGGTGGGAATGACGGGGAGGTGG - Intergenic
1063009061 10:2004505-2004527 GAGTGGGCATGACGGGGAGCTGG + Intergenic
1063383375 10:5600766-5600788 GAATGAGCATGAAGGGAAGACGG + Intergenic
1064110309 10:12532961-12532983 GGGTGGGTAGGAAGTGGGGATGG + Intronic
1064967177 10:21026924-21026946 GGGTGGCCAAGAGGGGGAGTGGG - Intronic
1065021039 10:21501567-21501589 GGGTGGGGAGGAAGAGGAGCAGG + Intergenic
1065204511 10:23344219-23344241 GGATGGGGGGGAAGGGGAGAGGG + Intronic
1066085158 10:31969114-31969136 GGCTCGGCATGAGAGGGAGAGGG - Intergenic
1066134481 10:32430358-32430380 GGGTGGGGGTGAATGGGAAAAGG - Intergenic
1066223092 10:33355325-33355347 AGGAGGGCAGGAAAGGGAGATGG - Intergenic
1066379230 10:34887230-34887252 GGGTGGGAAAGAAAGTGAGAAGG - Intergenic
1066445789 10:35481544-35481566 AGTTGGGCATGAAGGGAATAAGG + Intronic
1067188198 10:44047890-44047912 GCACGGGCGTGAAGGGGAGATGG - Intergenic
1067689872 10:48494835-48494857 GGGTGAGCTTGAGGGAGAGAGGG - Intronic
1067745411 10:48932039-48932061 GGTTGGCAATGAAGGGGAGTGGG - Intronic
1067756931 10:49012284-49012306 GTGCCGGCATGCAGGGGAGATGG + Intergenic
1067758835 10:49027568-49027590 GGGGTGGCATGCAGGGGTGATGG - Intronic
1067893227 10:50153348-50153370 GGGTGAGCAAGAGGGAGAGAAGG + Intergenic
1068045505 10:51881160-51881182 TAGTGCGCATGAAGGGGAGAGGG + Intronic
1068583209 10:58766273-58766295 GGGTGGGGATGAAAAGGGGATGG + Intronic
1069325112 10:67224245-67224267 GGGTTGGCATGTGGGGGAAACGG - Intronic
1069553107 10:69378138-69378160 GGCTGGGAAGGAAGGGGAGCGGG + Intronic
1069583398 10:69580068-69580090 GGGAAGGCAGGAAGGGGACAGGG + Intergenic
1069680636 10:70282976-70282998 GGGTGGGGTTGTTGGGGAGATGG - Intronic
1069696712 10:70391857-70391879 GAGAGGGCATGCAGGGGAGGGGG + Intergenic
1069794117 10:71041489-71041511 GGGGGGACATGAAAGGGAGCGGG - Intergenic
1069813300 10:71178343-71178365 GGATGGGCATCCAGAGGAGAGGG + Intergenic
1069826373 10:71257424-71257446 GGGTGGGCCTGGAGGGGGAAGGG - Intronic
1070917870 10:80166589-80166611 GGGTGGTCATGAAGAGGGCAGGG + Intronic
1071109983 10:82144449-82144471 GGGAGGCCATGAATGGAAGATGG - Intronic
1071128202 10:82360166-82360188 GGTTGGGGAAGAAGGGGAGTGGG + Intronic
1071164632 10:82791133-82791155 GTGGGGGCAGGAAGGGGAAAAGG - Intronic
1071284227 10:84129525-84129547 GGGTCAGAATGGAGGGGAGAAGG - Intergenic
1071287411 10:84161813-84161835 GGCTGGGTATGAAGGGGTGGGGG + Intergenic
1071471008 10:85984081-85984103 GGGAGGTCATGGAGGAGAGATGG - Intronic
1071856104 10:89626047-89626069 CTGTAGGCATGAAGGGGAGAAGG - Intronic
1072574547 10:96687995-96688017 GGGGAGGCATGAAGGGGTGGGGG + Intronic
1072731441 10:97849810-97849832 GGGAGGGCAGGAAGGGGAGGCGG + Intergenic
1073086123 10:100890329-100890351 GGGTGGAAAGGAAGGAGAGAGGG - Intergenic
1073597703 10:104817364-104817386 GGAGGGGGAGGAAGGGGAGAAGG - Intronic
1074439069 10:113459148-113459170 GGGAGGGCATGGAGGGAAGGAGG - Intergenic
1074828001 10:117228502-117228524 GGGAGGGAAGGAAGGGGAGAAGG - Intergenic
1075112188 10:119596524-119596546 GGGTGGGGAGGAAGGGGAGGGGG + Intronic
1075138228 10:119806751-119806773 GGGTGGGCTTGGAGGTGAGAGGG - Intronic
1075814802 10:125256693-125256715 GGGTGGGGATGGAGGGCTGATGG + Intergenic
1076114556 10:127886349-127886371 GAGTGGGCATGAAGGAGATGTGG + Intronic
1076130111 10:128008251-128008273 GGGAGGGAATGAGGGAGAGAGGG - Intronic
1076346051 10:129779921-129779943 GGGAGAGCAGGAAGAGGAGAAGG - Intergenic
1076382866 10:130037146-130037168 GGGTGGGGACCAAGGGGACAGGG + Intergenic
1076540417 10:131211021-131211043 GGGTGAGACAGAAGGGGAGATGG - Intronic
1076619518 10:131778344-131778366 GGGTGGGCAGGGAGGAGAGATGG + Intergenic
1077138692 11:1014034-1014056 GGGTGGGCATGGAGCGAGGAGGG + Intronic
1077317331 11:1925340-1925362 GGGTGGGGGAGAGGGGGAGAGGG + Intronic
1077360553 11:2138692-2138714 GGGCGGGCGTGAGGGGGGGAGGG + Intronic
1077529920 11:3090326-3090348 GGGTGGGGAAGAAAGGGAGTGGG - Intronic
1077642871 11:3897653-3897675 GGGTGGGCGTGGCGGGGGGAGGG - Intronic
1078103214 11:8342140-8342162 AGGTGGGGAGGAAGGGGAGGTGG + Intergenic
1078186453 11:9055732-9055754 GGCTGGGCCTGGAGGGGAGCAGG - Intronic
1078989596 11:16633018-16633040 GCCTGGGCATGAAGTGGAGAGGG + Intronic
1079300998 11:19278730-19278752 TGGTGGGCATTTAGGGGAGCTGG + Intergenic
1079324122 11:19476947-19476969 AGGGGGCCATGAAGAGGAGAGGG - Intronic
1079547240 11:21647446-21647468 GGTGGGCCATGAAGGAGAGATGG - Intergenic
1079565262 11:21875122-21875144 GACTGGGAATGAAGGTGAGAAGG - Intergenic
1079591783 11:22191779-22191801 GGGTGGGCAGGAAGTGGAGGGGG + Intergenic
1080550335 11:33369103-33369125 GGGAGGGGAGGTAGGGGAGAAGG - Intergenic
1080846623 11:36032653-36032675 GGGTTGTCATGATGGGGAGATGG - Intronic
1081250783 11:40830680-40830702 ACGTCGGCATGAAGGGTAGAGGG - Intronic
1081779861 11:45702762-45702784 AGGTGGGCAAGCAGGGGAAAGGG + Intergenic
1081844778 11:46232174-46232196 GGGTGGGGAGCAAGGGGAGGAGG + Intergenic
1081878545 11:46428191-46428213 GGGAGGGGAAGAAGAGGAGAGGG + Intronic
1081910596 11:46697459-46697481 GGGTGGGCAGGAAGAAGAGGGGG + Intronic
1082767366 11:57180343-57180365 GAGTCTGCATGAAGGGGAGCTGG + Intergenic
1083034960 11:59628521-59628543 GGGTGGGCAGGAGGGAGGGAGGG - Intergenic
1083176193 11:60951704-60951726 GGTAGGGCAAGAAAGGGAGAGGG - Exonic
1083224640 11:61277017-61277039 GGGAGGGAAGGAAGGAGAGAGGG + Intronic
1083260011 11:61517822-61517844 AGGGGGGCACCAAGGGGAGAAGG + Intronic
1083533780 11:63449925-63449947 GGGTGGGCAGAAAGGGGAGGGGG - Intergenic
1083618865 11:64039226-64039248 GGGTGGACAAGAAGGGGCGTGGG + Intronic
1083621852 11:64053187-64053209 GGGTGGGCGTGCTGGGGAGCAGG + Intronic
1083792475 11:64994775-64994797 GGGAGGGCAAGCAGGGAAGATGG + Intronic
1084362023 11:68674935-68674957 GGGTGGGCAGGAAGGGCCCAGGG + Intergenic
1084416725 11:69036753-69036775 GAATGGGCATGAAGGGAAGGGGG + Intergenic
1085027480 11:73244992-73245014 GAGTGGGCCTGGAGGGGAGGAGG + Intergenic
1085227646 11:74936820-74936842 GGGTGGGGAGGAAGTGGGGAAGG - Intronic
1085502701 11:77038073-77038095 GGGAGGGGATGAGGGGGAGGAGG + Intronic
1085525475 11:77161250-77161272 GGATGGGAAGGAAAGGGAGAGGG - Intronic
1085603884 11:77880198-77880220 GGGTAGGAATGAAGGCTAGATGG + Intronic
1085745248 11:79109518-79109540 CGGTTGCCATGCAGGGGAGAGGG + Intronic
1085943950 11:81243367-81243389 GGGAAGGCATGAAGGGCAGTGGG - Intergenic
1086126219 11:83351242-83351264 GGGTGGGCATGATGGTGAGCTGG - Intergenic
1086164745 11:83764458-83764480 GGGTGTGCAGGGAAGGGAGAAGG + Intronic
1086329600 11:85740348-85740370 GACTGGGCATGAAGAGGATAGGG - Intronic
1086361783 11:86068294-86068316 GGGTGGGAAGGAAGAGCAGAAGG + Intronic
1086405749 11:86497777-86497799 GGGTGGGCAACCAGGGAAGAAGG + Intronic
1086500610 11:87449278-87449300 GAGATTGCATGAAGGGGAGAGGG + Intergenic
1086856520 11:91872315-91872337 GGATGGGAATACAGGGGAGAGGG - Intergenic
1087122779 11:94592114-94592136 GGGTGGGGAGGAAAAGGAGATGG - Intronic
1087356241 11:97097969-97097991 GCCTGGGCATGAAGCTGAGAGGG - Intergenic
1087714915 11:101596589-101596611 TAGTGGGCATGGAGGGGGGATGG + Intronic
1088427136 11:109716203-109716225 GGGTGATGAAGAAGGGGAGAGGG + Intergenic
1088612407 11:111590535-111590557 GGATGGGGCTGAAGGGGAGGGGG - Intergenic
1089194285 11:116684053-116684075 GGGTGGGGGTGGAGGGGAGCGGG - Intergenic
1089251742 11:117168416-117168438 CGGGGGGAATGAAGGGGAAAGGG - Exonic
1089559438 11:119336427-119336449 GGGTGGGCAGGCAGGGAAGGAGG - Exonic
1089575861 11:119442664-119442686 GGGTGGGGAGGAAGGGTGGATGG - Intergenic
1089697183 11:120223092-120223114 AGATGGGCATGATGGGGAGCGGG + Intronic
1089719594 11:120402570-120402592 TGGTTGAAATGAAGGGGAGATGG - Intronic
1089751237 11:120652707-120652729 GGGGCGGCAGGAAGGGTAGAGGG - Intronic
1090262244 11:125330101-125330123 GGAGGAGCATGGAGGGGAGAAGG + Intronic
1090277697 11:125431454-125431476 GGGTGGGGGGGAAGGGGACATGG + Exonic
1090352154 11:126114580-126114602 AGCTGGGCATGCAGGGGAAAAGG + Intergenic
1090806993 11:130209006-130209028 GGGTGGGTATGAAGGGAAGCAGG + Intronic
1091034356 11:132219813-132219835 GGGTGGGAGTGAAGAGGAGGGGG - Intronic
1091056128 11:132420707-132420729 GGTGGGGTAGGAAGGGGAGACGG + Intronic
1091167448 11:133492172-133492194 GAGTGGACAGGAAGGGAAGAGGG + Intronic
1091378407 12:41288-41310 GGCTCGGCATGAGAGGGAGAGGG - Intergenic
1091455622 12:605234-605256 GGCTGTGCATCATGGGGAGAGGG + Intronic
1091796682 12:3301248-3301270 GAGTGAGGATGAAGGGGAGCAGG + Intergenic
1091815821 12:3437079-3437101 GGGTGGGGTTGAAGGGGTAAGGG - Intronic
1091827433 12:3523440-3523462 GGGTGGGCTTGGGGTGGAGATGG - Intronic
1091828666 12:3534035-3534057 AGGTGGGCAAGGAGGGAAGAAGG + Intronic
1091832279 12:3558112-3558134 GGGTGGGCCGGCAGGGGAGGTGG + Intronic
1092015522 12:5155524-5155546 GGGTGTGGATAAAGGGGAGGTGG - Intergenic
1092045339 12:5428484-5428506 GGGTGGGGATGGAGGGGGTAGGG + Intergenic
1092113390 12:5980591-5980613 GGGTGGGCAGGAAGACGAGAAGG + Intronic
1092278668 12:7082183-7082205 GAGTGTGCTTGATGGGGAGAGGG + Intronic
1092288595 12:7144751-7144773 GGGTGGGTTTAGAGGGGAGAGGG + Intronic
1092997266 12:13962271-13962293 GGGTGGGCATGAAGTAGATGTGG - Intronic
1093310809 12:17581198-17581220 GGGAGGGAAGGAAGGAGAGAGGG + Intergenic
1093800652 12:23367740-23367762 GGGTGGACAGGAATGGAAGATGG + Intergenic
1094541321 12:31365364-31365386 GGGTGGGGAGGAAGGAGAAAAGG + Intergenic
1094842902 12:34349388-34349410 GGGTGGGTGTGGAGGGGACAAGG + Intergenic
1095094426 12:38138231-38138253 GGGTGGGCATGAGCGGGCCAGGG - Intergenic
1095861927 12:46926921-46926943 GAGGGGGCATTAAGAGGAGATGG - Intergenic
1095952732 12:47790388-47790410 CGGGGGGCATGATGGGGAGATGG + Intronic
1096518265 12:52170264-52170286 GAGTGGGCATGGAGGGAGGAAGG + Exonic
1096523143 12:52195269-52195291 GGGTGGGAGTGACGTGGAGAAGG - Intergenic
1097087894 12:56482276-56482298 GTGTGGGCATGATGGGGAATAGG - Intronic
1097251304 12:57633518-57633540 GGGCGGGGAGGAGGGGGAGAGGG - Intergenic
1098178443 12:67819163-67819185 GGGCTGGCAGGAAGGGGAGATGG - Intergenic
1099005770 12:77233210-77233232 GGGAGGGAATGAAGGAAAGAAGG - Intergenic
1100570922 12:95842341-95842363 GGCTCGGCATGAGAGGGAGAGGG + Intergenic
1100846996 12:98669885-98669907 GGGAGGGCAGGAAGAGGGGAGGG - Intronic
1100847002 12:98669901-98669923 GGGAGGGCAGGAAGAGGGGAGGG - Intronic
1100875219 12:98954918-98954940 GGGTGGGCAGGAGGGAGGGAGGG - Intronic
1101565656 12:105902577-105902599 GGGTGGGGATGAAGGACTGATGG - Intergenic
1101868035 12:108537137-108537159 GGGGGGACATGAAGGGGCAAAGG + Intronic
1102575549 12:113853975-113853997 TGGTGGGCATGGTAGGGAGAAGG + Intronic
1102695731 12:114797893-114797915 GGATGGGCAGGAGGGAGAGAAGG - Intergenic
1102770336 12:115470679-115470701 GGGTGGGCAGGAAGGTGTGGCGG - Intergenic
1102948516 12:117011383-117011405 GGGTGGGTATCTAGGGGTGAAGG - Intronic
1102991893 12:117321936-117321958 GGGAGGGAAGGAAGGAGAGAGGG - Intronic
1102991905 12:117321976-117321998 GGGAGGGAAGGAAGGAGAGAAGG - Intronic
1102991910 12:117321996-117322018 GGGAGGGAAGGAAGGAGAGAGGG - Intronic
1102991962 12:117322194-117322216 GGGAGGGAAGGAAGGAGAGAGGG - Intronic
1103052357 12:117791158-117791180 TGGTGGGCATAAAGGAAAGAAGG - Intronic
1103131964 12:118477067-118477089 GGGAGGGAAGGAAGGAGAGAAGG - Intergenic
1103549432 12:121726096-121726118 GGGTTAGGAAGAAGGGGAGATGG + Intronic
1103912638 12:124360746-124360768 GGGTGGGCATTGCGGGCAGAGGG - Intronic
1104668789 12:130666757-130666779 GGGAGGGAAGGAAGGAGAGAGGG + Intronic
1104668892 12:130667117-130667139 GGGAGGGAAGGAAGGAGAGAGGG + Intronic
1104683769 12:130771142-130771164 GGGTAGCCATTAAGGGGAGGCGG - Intergenic
1104691117 12:130827088-130827110 GGGAGGGGAGGAAAGGGAGAGGG + Intronic
1104843216 12:131834428-131834450 GGGTGGGCGTGGAGGGGGGCAGG + Intronic
1105284424 13:18993001-18993023 GGGTTGGCAAGAAGGCCAGAAGG + Intergenic
1105453497 13:20520658-20520680 GTGTGGGCGTGAAGGGGTGGGGG - Intronic
1105705015 13:22963226-22963248 AGGAGGGAATGAAGGAGAGAGGG + Intergenic
1105705063 13:22963392-22963414 GGGTGGGAAGGAAGGAGGGAGGG + Intergenic
1105857972 13:24388404-24388426 AGGAGGGAATGAAGGAGAGAGGG + Intergenic
1106014595 13:25856747-25856769 GGCTGGGGAGGAAGGGGAGAAGG - Intronic
1106717880 13:32409806-32409828 TGGAGGGCTTGTAGGGGAGAAGG + Intronic
1106840162 13:33678274-33678296 GGGTGGGCGCTAAGGGGAGATGG + Intergenic
1107114872 13:36735693-36735715 GGATGGGGATGAAGGCGAGGAGG + Intergenic
1107297097 13:38921265-38921287 GCCTGGGCATGAAGTAGAGAGGG + Intergenic
1107411456 13:40162305-40162327 TGGTGGGCATGAACGGCAGCAGG - Intergenic
1107422563 13:40262192-40262214 GGGAGGGAAGGAAGGAGAGAGGG + Intergenic
1107585902 13:41848083-41848105 GGGTGAGGGTGATGGGGAGAAGG + Intronic
1107662223 13:42650446-42650468 GGGAGGGGAGGAGGGGGAGAAGG + Intergenic
1107788488 13:43977802-43977824 GGGAGGGAAGGGAGGGGAGAGGG - Intergenic
1108557856 13:51613280-51613302 GCTTGGGAAAGAAGGGGAGATGG - Intronic
1108651336 13:52482974-52482996 GGGAGGGCCTGATGGGGGGAGGG - Intergenic
1109405820 13:61898812-61898834 GGGAGGGAAGGAAGGGAAGAAGG - Intergenic
1110456345 13:75694351-75694373 GTGTGAGAATGAAGGGGCGAAGG + Intronic
1110638233 13:77790998-77791020 GCCTGGGCATGGAGTGGAGAGGG - Intergenic
1110999080 13:82154788-82154810 GCCTGGGCATGCTGGGGAGATGG + Intergenic
1111118279 13:83811162-83811184 TGGTAGGTATGAAGGGCAGATGG - Intergenic
1111464563 13:88592233-88592255 GCTTGGGCATGAAGTGCAGAGGG - Intergenic
1112052728 13:95659486-95659508 GGGTGGACATGAATGAGAGAAGG - Intergenic
1112223280 13:97513324-97513346 GCCTGGGCATGAAGTGGAAAGGG + Intergenic
1112312564 13:98332233-98332255 GGGGGTGGAGGAAGGGGAGAGGG - Intronic
1112380725 13:98886814-98886836 GGAAGGGCAGGAAGGGGAGCAGG - Intronic
1112569096 13:100577815-100577837 AGGGAGGGATGAAGGGGAGAAGG + Intronic
1112752953 13:102600157-102600179 AGGTGGGGATGAAGGGGCTATGG - Intronic
1113571689 13:111362444-111362466 GGCTGGGGCTGAAGGGCAGAGGG + Intergenic
1113637513 13:111929707-111929729 GGGGGGGCATGGAGGGAGGAAGG + Intergenic
1113675206 13:112202301-112202323 GCGTCGGCATGAAGGGGAAAGGG + Intergenic
1113810279 13:113137344-113137366 GGGTTGGCAGGTGGGGGAGATGG + Intronic
1113936614 13:113998253-113998275 GGGTTGGGAAGAGGGGGAGATGG - Intronic
1113975563 13:114225414-114225436 GGGAGGGGAGGAAGGGGAGGGGG + Intergenic
1114459411 14:22877200-22877222 GGGTGGGCAAGATGGGGAGCAGG + Exonic
1114492561 14:23112642-23112664 GGCTGGGGATGGAGGGGAGAAGG + Intergenic
1115046962 14:29006446-29006468 GGGAGGACATGCTGGGGAGAAGG - Intergenic
1115975769 14:38995429-38995451 GGGTGGGCATAAAGGGAAGAGGG - Intergenic
1116065158 14:39972793-39972815 GGGTGAGCAGGAAGGAGAGGAGG + Intergenic
1116468655 14:45262197-45262219 GGCTGGGAATGATAGGGAGAAGG - Intergenic
1116701396 14:48247862-48247884 GGATGAGGATGAAGGGGTGAAGG - Intergenic
1118221631 14:63859931-63859953 GGGAGGGAAGGAAGGGGAGAAGG - Intronic
1118341416 14:64896646-64896668 GGCTCGGCATGAGAGGGAGAGGG + Intergenic
1118708167 14:68499062-68499084 AGGTTGGCAAGAAGAGGAGAAGG + Intronic
1119648509 14:76366595-76366617 GTGTGCACGTGAAGGGGAGATGG + Intronic
1119895909 14:78219918-78219940 GGATGGGGATGGAGGGTAGAAGG + Intergenic
1120039197 14:79733134-79733156 AGGTGGGGGTGAAGGGAAGATGG + Intronic
1120421590 14:84292811-84292833 AGGTGGACATGAATGGGAGTGGG + Intergenic
1120838877 14:89065244-89065266 GGGTGAGCCTGGATGGGAGATGG + Intergenic
1120898919 14:89558954-89558976 GGGTGGGCAAGAATGCGAGGGGG - Intronic
1120900998 14:89575390-89575412 GGGTGGGGATGATAGGGAGAAGG + Intronic
1121241892 14:92436877-92436899 GGGTGTGGGTAAAGGGGAGAAGG - Intronic
1121316558 14:92964403-92964425 GGGTGGGGAGGGAGGGGAGCTGG + Intronic
1121325640 14:93018150-93018172 AGATGGGCAAGAAGGAGAGAGGG + Intronic
1121612811 14:95293159-95293181 GGGAGGGAAGGAAGGAGAGAGGG - Intronic
1121613869 14:95299775-95299797 GGTTGGGCAGGGAAGGGAGAGGG - Intronic
1121659481 14:95624270-95624292 GGGAGGGCAGGAAGGAGGGAAGG + Intergenic
1121668772 14:95692253-95692275 TGGTGGGTATGAAGGGGATTTGG - Exonic
1121787511 14:96673554-96673576 GGGAGGGCAGGCAGGGGAGAAGG - Intergenic
1121798742 14:96756073-96756095 GGGTGGGCAAGAAGGGAAGGCGG + Intergenic
1121861608 14:97324079-97324101 GGGTGGCCATGAAGGGAGCAGGG - Intergenic
1122002054 14:98666927-98666949 GGGAGGGAAGGAAGGAGAGAGGG - Intergenic
1122327877 14:100893376-100893398 GGGTGGGCAGGCAGGGGAGGTGG - Intergenic
1122606033 14:102948192-102948214 GGGTGGGCGTGGAGGTGACAGGG + Intronic
1122606074 14:102948287-102948309 GGGTGGGTGTGGAGGTGAGACGG + Intronic
1122606250 14:102948707-102948729 GGGTGGGTGTGGAGGTGAGAGGG + Intronic
1122651771 14:103230374-103230396 GGATGGTCATGGAGCGGAGAGGG + Intergenic
1122655737 14:103258331-103258353 GGGCGGGCAGGGTGGGGAGAGGG - Intergenic
1123014624 14:105367852-105367874 GGGTTGGCAGGAAGTGGGGAGGG - Intronic
1124562560 15:30788843-30788865 GGGAGGGAGTGAAGGGGAAAAGG - Intergenic
1124632784 15:31346911-31346933 GGGTGGGCCAGCAGGGGAGAGGG + Intronic
1124649553 15:31464854-31464876 GGGTGGACACGAAGGGGCCATGG + Intergenic
1124957749 15:34370836-34370858 GGGAGGGGATGAAGAGGAGGAGG - Intergenic
1125252206 15:37717950-37717972 GGGTGGGGTGGAAGGGGAGGGGG - Intergenic
1125267246 15:37897127-37897149 GGGGGGGAAGGAAGTGGAGATGG + Intergenic
1125348372 15:38742400-38742422 GGCTGGTCAGGAATGGGAGAGGG - Intergenic
1125542917 15:40481533-40481555 TGGTGGGGAGGGAGGGGAGATGG - Intergenic
1125591285 15:40856081-40856103 GGGTGGGCATGTATGGGGGAAGG + Intronic
1125716451 15:41822462-41822484 AGGTAGGCAAGGAGGGGAGAAGG - Intronic
1126654073 15:50956922-50956944 GGGTGAGCATGCAGGTGAGCGGG + Intronic
1126825372 15:52543043-52543065 GGTGGGGTATGAAGGGAAGAGGG - Intergenic
1127313826 15:57776469-57776491 GGGTGGGGAGGAGGGGGAAAGGG + Intronic
1127681272 15:61300825-61300847 GGCTGTGCATGTATGGGAGAGGG + Intergenic
1127734265 15:61827455-61827477 GGGTTTGCATGAAGCTGAGAAGG - Intergenic
1128094644 15:64944489-64944511 TTCTGGGCATGAAGGGGATATGG - Intronic
1128304181 15:66587107-66587129 GGGGGAGGAGGAAGGGGAGAAGG - Intronic
1128382076 15:67120554-67120576 GGGTGGTCTAGAAGGGCAGATGG + Intronic
1128441892 15:67717780-67717802 AGCTAGCCATGAAGGGGAGATGG - Intronic
1128648996 15:69396882-69396904 GGGTGGCAATGAAGAAGAGAAGG + Intronic
1128657162 15:69470723-69470745 GGGTGGGGGTGAGGGGCAGAAGG - Intergenic
1129077828 15:73012622-73012644 GGGAGGGAGGGAAGGGGAGAGGG - Intergenic
1129453207 15:75662336-75662358 GGGTGGGCAGGGCGGGGAGGAGG - Intergenic
1129573845 15:76719379-76719401 GGGTGTGCATAAGAGGGAGAGGG + Intronic
1129785439 15:78306968-78306990 GGTGGGGCATGGAGGAGAGAAGG - Intergenic
1130396212 15:83504377-83504399 GGGTGGGTATGAAGACCAGAAGG - Intronic
1130715479 15:86329536-86329558 GCCTGGGCATGAAGTGGAGAGGG - Intronic
1130876622 15:88020125-88020147 GGGCAGGCATACAGGGGAGAAGG + Intronic
1131650166 15:94389315-94389337 GGGTGGGCATGGAGGGGAAGTGG + Intronic
1131830961 15:96354321-96354343 GGGTGGGGTTGAAGGCGAGTGGG - Intergenic
1131938065 15:97529147-97529169 GGGAGGGCAGGAAGGAGGGAGGG - Intergenic
1132024424 15:98392747-98392769 GTGTAGGCATGAAGGAGAAAAGG - Intergenic
1132092689 15:98958771-98958793 GAGTGAGCAGAAAGGGGAGAGGG - Exonic
1132156133 15:99496361-99496383 GTGTGGGCAGGGAGGGCAGAAGG + Intergenic
1132537734 16:491440-491462 GGCTGCGCATGCAGGGGAGGAGG - Intronic
1132614856 16:835405-835427 TGATGGGCCTGAAGGGGAGGGGG + Intergenic
1132698773 16:1213428-1213450 GAGTGGGTATGAAGCTGAGATGG - Intronic
1132719261 16:1307922-1307944 GGGTGGGAATGAATGAGGGAGGG + Intergenic
1132719327 16:1308249-1308271 GGGAGGGAATGAATGAGAGAGGG + Intergenic
1132752357 16:1464652-1464674 GGTGGGGCCTGATGGGGAGAAGG + Intronic
1132763189 16:1520932-1520954 GGGTGGGTATGGAGGGGACAAGG + Intronic
1132841186 16:1979183-1979205 GGGTGGGCACGGTGGGGGGAGGG + Exonic
1133031772 16:3014451-3014473 GGGTGGGGATGTTGGGGAGAGGG - Exonic
1133036074 16:3035144-3035166 GGGTGGGCCTGGAGAGGACAAGG - Intronic
1133305227 16:4804222-4804244 CGGTGGGCATGCAGGGGACTTGG + Exonic
1133314259 16:4872465-4872487 GGGTGGGCATGGTGGGGGGGCGG + Intronic
1133701186 16:8310636-8310658 GGGGGTGCATGAAGGGCAGAAGG + Intergenic
1133787879 16:8986979-8987001 GGGAGTGCATGAAGGGAAGTAGG - Intergenic
1133816302 16:9199975-9199997 GGGAGGGAAGGAAGGAGAGAAGG - Intergenic
1134030999 16:10992254-10992276 GGATGGGGAAGATGGGGAGAGGG - Intronic
1134909502 16:18011758-18011780 GGGCGGTGAAGAAGGGGAGATGG - Intergenic
1135165800 16:20138185-20138207 GGAAGGGAAAGAAGGGGAGAGGG - Intergenic
1135173621 16:20208851-20208873 GGGTGGGTATTGAGGGGACAGGG + Intergenic
1135195548 16:20391397-20391419 TGGTGAGCATGATGTGGAGACGG - Intronic
1136068730 16:27775657-27775679 TGGTGGAGAGGAAGGGGAGAGGG + Intronic
1136072003 16:27792808-27792830 GGCTGGGAGTGAAGGGGGGAAGG + Intronic
1136413714 16:30091396-30091418 GGGTGGGGAGGGAGGGGAGGAGG - Intronic
1136730343 16:32405933-32405955 GGGAAGGGATGAAGGGAAGAAGG - Intergenic
1137603885 16:49774414-49774436 AGGTGGGCAGGAGAGGGAGAGGG + Intronic
1137614026 16:49836367-49836389 GGGTTGGCATGGAGGGAAGGGGG + Intronic
1137700620 16:50495403-50495425 GAGAGGCTATGAAGGGGAGAGGG - Intergenic
1138565352 16:57828780-57828802 GGCTGGGCTTGTAGTGGAGAGGG - Intronic
1139090083 16:63635023-63635045 GGGAGGGGATGAAGGGTAAAAGG - Intergenic
1139342642 16:66278463-66278485 GCCTTGGCATGGAGGGGAGAAGG - Intergenic
1139366003 16:66433989-66434011 GCGGGGACATGAAGGGGAGTGGG + Intronic
1139527614 16:67526439-67526461 GGGTGGGCATGGTAGGGGGAGGG + Intronic
1140024434 16:71271919-71271941 GGGTGGGCTGGAAGGTAAGAAGG + Intergenic
1140268317 16:73439885-73439907 AGTGGGGCAGGAAGGGGAGAGGG + Intergenic
1140732876 16:77872231-77872253 AGGTGGGTACGCAGGGGAGAGGG - Intronic
1140736181 16:77899870-77899892 GGGTGAGGCTGAAAGGGAGATGG - Intronic
1141029466 16:80575058-80575080 TGGGGGGCAAGAAGGTGAGAGGG + Intergenic
1141210307 16:81973517-81973539 GCCTGGGCATGGAGCGGAGAGGG - Intergenic
1141424624 16:83936752-83936774 GAGTGAGCAGGAAGGCGAGACGG - Intronic
1141610587 16:85178876-85178898 GGGTGGGCAGGGAGGGATGAGGG + Intronic
1141611415 16:85183224-85183246 GAGTGTGCATGAATGAGAGAGGG - Intronic
1141855396 16:86677732-86677754 GTGTGGGGATGGCGGGGAGAGGG - Intergenic
1142607550 17:1090469-1090491 GGGTGGCCAAGAAGAGGAAAAGG + Intronic
1142767782 17:2075311-2075333 GGGTGGGCGGGAAAGGGACAGGG + Intronic
1142964694 17:3573286-3573308 GGGTGGTCCTGGAGGGAAGAAGG - Intronic
1143140826 17:4740878-4740900 GGATGGGGAGGAAGGGGAGGAGG + Exonic
1143592676 17:7894973-7894995 GGGAGAGGAAGAAGGGGAGAAGG + Exonic
1143624925 17:8104220-8104242 GTGTGGGGAGGAAGGGTAGAGGG + Intronic
1143953881 17:10654079-10654101 GGTTGGGCATGAAGGAAAAAAGG - Intronic
1144034405 17:11352686-11352708 GGCTGAGCATGATGGAGAGAGGG + Intronic
1144038921 17:11391218-11391240 GGGTGGGCAGGAAGGTGATGGGG + Intronic
1145733482 17:27211421-27211443 GGCTCGGCATGAGAGGGAGAGGG - Intergenic
1146125839 17:30230711-30230733 GGTGGGGCATGGAGGGGAGAAGG + Intronic
1146287026 17:31581103-31581125 AGCTGGGCAGGAAGGAGAGAGGG - Intergenic
1146676001 17:34774347-34774369 GGGAGGGCAGGGAAGGGAGAAGG - Intergenic
1146959791 17:36964302-36964324 GAGTGGGGATGGAGTGGAGATGG + Intronic
1147407909 17:40226588-40226610 GGGAGGGCAGGAATGGAAGAAGG - Intronic
1147466781 17:40616692-40616714 CGGAGTGCATGAGGGGGAGAGGG - Intergenic
1147596802 17:41723069-41723091 GCATGGGCATCAAGGGGTGAGGG + Exonic
1147716483 17:42512228-42512250 AGCTGGGAATGAAGGAGAGAAGG + Intronic
1147953460 17:44119751-44119773 GGTGGGACATGAAGGGGAGAAGG + Intronic
1148468210 17:47877508-47877530 GGGTGGGCACTAATGGGAAAAGG + Intergenic
1148688535 17:49513797-49513819 GGGTGGGCAGGCAGTGGGGAAGG - Exonic
1148737044 17:49870824-49870846 GGCTGAGCAGGAAGGGGAGAGGG - Intergenic
1148737824 17:49874663-49874685 AGGTGGGCGTGGAGGGGAGGGGG - Intergenic
1148750037 17:49940370-49940392 GGGAGGGCAGAAAGTGGAGAGGG + Intergenic
1148772500 17:50075563-50075585 GGGTGGTCAGCAAGGGGACAGGG - Intronic
1148792946 17:50183754-50183776 GGATGGGCTTGAAGGGGAGTGGG + Exonic
1148863845 17:50618540-50618562 GGATGGGAAGGAAGGGGAGGAGG - Intronic
1149020768 17:51961942-51961964 GCTTGGGCATGAAGTGGAGAGGG - Intronic
1149112106 17:53046455-53046477 GCCTGGGCATGAAGCAGAGAAGG - Intergenic
1149498087 17:57132126-57132148 GGGTGGGCTGGAGGGGGTGAGGG + Intergenic
1149498270 17:57132606-57132628 GGGTGGGCTGGAGGGGGTGAGGG + Intergenic
1149498292 17:57132654-57132676 GGGTGGGCTGGAGGGGGTGAGGG + Intergenic
1149532437 17:57406357-57406379 GGAGGGGCCTGAAGGGGAGAAGG - Intronic
1149643241 17:58218883-58218905 GGGGAAGAATGAAGGGGAGAGGG + Intronic
1149752166 17:59155908-59155930 GGCTGGACACGAAGGGGAAATGG + Intronic
1149979353 17:61297284-61297306 GGCTGGGGATGGAGGAGAGAAGG + Intronic
1150182910 17:63145303-63145325 GAGTGGGAAAGAAGGGTAGAAGG - Intronic
1150199582 17:63340906-63340928 GCATGAGCATGAATGGGAGATGG - Intronic
1150563743 17:66319119-66319141 GGGTGGGGGTGGAGGGGACAGGG - Intronic
1150618225 17:66788871-66788893 CTGTGGGCCTGAGGGGGAGAGGG + Exonic
1150835063 17:68556587-68556609 GGTTTGGCTTGAAGGGGACAGGG + Intronic
1151453634 17:74213851-74213873 GGGTGGGGGAAAAGGGGAGAGGG - Intronic
1151494140 17:74449551-74449573 GGCTGGGCAGGAAAGGGAGGTGG - Intronic
1151501272 17:74490856-74490878 GGGGTGGCCTGAAGCGGAGATGG + Intergenic
1151654332 17:75488802-75488824 GGGTGAGGGTGGAGGGGAGAAGG - Exonic
1151660581 17:75516176-75516198 GGCTGGGCAAGGAGGGCAGAAGG - Intronic
1151961045 17:77405818-77405840 GGATGGGCCTGAAGGAAAGATGG - Intronic
1152058375 17:78050296-78050318 GGGAGGGAAGGAACGGGAGAAGG + Exonic
1152243012 17:79170016-79170038 GGAAGGGCAGGAAGGAGAGAAGG + Intronic
1152247712 17:79193948-79193970 GGGAGAGCATGAAGGGAGGAAGG + Intronic
1152380601 17:79940767-79940789 GGCTGGGCGTGAAGGGGACAGGG - Exonic
1152556425 17:81055356-81055378 TTGTGGGCATGAATGGGACAGGG + Intronic
1152754981 17:82083470-82083492 GGGTGGGCATGGATGGGTGTGGG - Intronic
1152821741 17:82441095-82441117 GGGAGGGGAAGAAGGGGACAGGG - Exonic
1152863404 17:82709076-82709098 GGGTGGGTGGTAAGGGGAGAGGG - Intergenic
1153661747 18:7331908-7331930 GGGTGTGGAGGAAGGGGAGGGGG - Intergenic
1153976769 18:10275152-10275174 GGGTGGGAATGAAGTGGGAATGG + Intergenic
1153987844 18:10368841-10368863 GGGAGGGAAAGAGGGGGAGAGGG + Intergenic
1154275166 18:12952745-12952767 GGGTGGGAGGGGAGGGGAGAGGG - Intronic
1154283925 18:13034223-13034245 GGGTGGGGAGGAAAGGGAAACGG + Intronic
1154406901 18:14100667-14100689 GAGTGGGTATGGTGGGGAGAAGG + Intronic
1154484857 18:14865465-14865487 GGATGAGCAGGAAGGAGAGAAGG - Intergenic
1155165289 18:23227236-23227258 GGGTGGGGAGGAAGGGGGCATGG - Intronic
1155569181 18:27171284-27171306 GGGTGGGCATGGGGAGGACATGG + Intronic
1155612630 18:27684185-27684207 GGGTGGGAATGAATGGAAGAGGG - Intergenic
1156061823 18:33086807-33086829 TGGTGTGTGTGAAGGGGAGAGGG + Intronic
1156354788 18:36331786-36331808 GTGTGGCCATGCAGGGGAGTGGG + Intronic
1156426570 18:37019901-37019923 GCCTGGGCATGAAGGAGAGAGGG + Intronic
1157329524 18:46693200-46693222 GGGTGGGCACGTGAGGGAGAAGG - Intronic
1157566019 18:48679858-48679880 GGGTGGCCTGGGAGGGGAGAGGG + Intronic
1157940345 18:51921706-51921728 GCCTGGGCATGGAGTGGAGAGGG - Intergenic
1158403055 18:57138703-57138725 GGGTGTGCATGTGGGGCAGAAGG - Intergenic
1159881082 18:73859122-73859144 AGGGGGGCATGCAGGGAAGAAGG + Intergenic
1160154287 18:76421570-76421592 GGGTTTGCTTGAAGGGGAAATGG + Intronic
1160699531 19:499109-499131 GGGAGGACAGGAAGGGGACAGGG - Intronic
1160972459 19:1775634-1775656 GAGTGGGCATGGAGGGAGGAAGG - Exonic
1161104474 19:2436660-2436682 GGGTGGCCGTGGAGGCGAGAGGG - Intronic
1161431274 19:4233666-4233688 GGGAGGGCATGGAGGAGACAGGG - Intronic
1161473024 19:4470423-4470445 GGGAGGGCATGAGGAGCAGAGGG - Intergenic
1161505788 19:4642748-4642770 GGGAGGGCAGGGAGGGGACAGGG + Intronic
1161619200 19:5289556-5289578 GGGAGGGCACGGAGGGGACAGGG - Intronic
1161841867 19:6686719-6686741 GGGTTGGCCTGGAGGGGTGAAGG - Intronic
1161994953 19:7706293-7706315 GGGTGGGGAGGAAGGGCAGTAGG + Intergenic
1162013810 19:7832816-7832838 GGGTGGGCATGAGGGGCTGTCGG + Intronic
1162444313 19:10712894-10712916 GGCAGGGCATGGAGGGGACAGGG + Intronic
1162805719 19:13137115-13137137 GGGTAGAGATGTAGGGGAGAAGG + Intronic
1163103684 19:15111452-15111474 GGGTGAGCAGGCAGGGGAGAGGG - Intronic
1163176703 19:15569290-15569312 GGGCTGGCTTGAAGGAGAGATGG + Intergenic
1163266680 19:16226300-16226322 GGATGGGCTTGGAGGTGAGAAGG + Intronic
1163446087 19:17347361-17347383 GGGTGGGCTTGAAGTGGGGAGGG + Intergenic
1163475596 19:17524209-17524231 GGATGGGCATGGAGGGGTCACGG - Intronic
1163502862 19:17686859-17686881 GGGTGGGCAGGCCGGGGAGCCGG - Intronic
1163648129 19:18501835-18501857 GGGTGGGCAGGAAGGAGGGGAGG + Intronic
1163672180 19:18636024-18636046 GGGTGTGCAGGGTGGGGAGAGGG + Intergenic
1164066274 19:21720379-21720401 GGCTCGGCATGAGAGGGAGAGGG - Intergenic
1164425995 19:28142452-28142474 GGGAGAGAAGGAAGGGGAGAGGG + Intergenic
1164925706 19:32128398-32128420 GGGAGGGAAGGAAGGGGGGAGGG + Intergenic
1165736993 19:38183219-38183241 GGGAGGGCATGGAGCAGAGAGGG + Intronic
1166349491 19:42188775-42188797 GGGAGGGAAGGAAAGGGAGAGGG + Intronic
1166894536 19:46015536-46015558 GGGCGGGGCTGAAGGGGAGGCGG + Intronic
1166918253 19:46210860-46210882 GGGTGTGCATGATGTGGAGGTGG + Intergenic
1167468399 19:49662342-49662364 GCAGCGGCATGAAGGGGAGAGGG + Intronic
1167691071 19:50983808-50983830 GGGTGCACCTGTAGGGGAGAGGG - Exonic
1167691750 19:50989242-50989264 GGGAGGGTATGAAGAGGATAAGG - Intergenic
1168292872 19:55365636-55365658 GGGTGGGGACGGAGGGGAAAGGG - Exonic
1202715678 1_KI270714v1_random:41163-41185 GGGTGGACATGGACGGGTGAAGG + Intergenic
925008214 2:461961-461983 GGGCGGGTATGAGGGAGAGAAGG - Intergenic
925032211 2:659675-659697 GGGAGGGAAGGAAGGAGAGAGGG + Intergenic
925056349 2:860524-860546 GGGTGGGGGTCCAGGGGAGAGGG - Intergenic
925768447 2:7259712-7259734 GCCTGGGCATGGAGTGGAGAGGG - Intergenic
926104377 2:10141313-10141335 GGGAGGGGATGGAGGGAAGATGG - Intergenic
926283980 2:11472904-11472926 GGGCGGGGAGTAAGGGGAGAGGG - Intergenic
927041893 2:19238370-19238392 AGGTGGGAATTAAGGGGTGAGGG + Intergenic
927109634 2:19855196-19855218 GAGTGGGCTGGAAGGGGACAAGG - Intergenic
927287274 2:21369843-21369865 GGGAGGGGAAGAAGGGGAGGAGG - Intergenic
927428614 2:23007993-23008015 GGGTGGGGCTGAAGGGGAGAGGG + Intergenic
927498167 2:23564371-23564393 GGGTGGCCAGGAGGGGGAGAGGG + Intronic
928088215 2:28358865-28358887 GGGTGGGCATTCAGGAGAGGTGG + Intergenic
928111844 2:28516895-28516917 GCGTGTGTATGGAGGGGAGAGGG + Intronic
928129247 2:28637761-28637783 GAGTGGGCAAGGAGGTGAGAAGG - Intronic
929787169 2:45001319-45001341 TGGTGAGCAGGAAGGGAAGAAGG - Intergenic
929830500 2:45343182-45343204 GGGTGGGCAGGCAGTGGAGGGGG - Intergenic
929885325 2:45872839-45872861 GGGTGGGCATGGAGGGGCAGCGG + Intronic
930210811 2:48635098-48635120 GCCTGGGCATGGAGTGGAGAGGG + Intronic
931667749 2:64622654-64622676 GGGAGGGCAGGAAGGGGATGTGG - Intergenic
931798149 2:65731736-65731758 GGCTGGCCAAGAAGGGAAGATGG + Intergenic
932211096 2:69931306-69931328 GGGTGGGCAGGAGGTGGGGATGG - Intronic
932236587 2:70125368-70125390 GTGTGGGCGTCAGGGGGAGACGG - Intergenic
932355831 2:71067990-71068012 GGGTGGGTAGGAAGAGGTGAAGG + Intronic
932411247 2:71549297-71549319 GGGTGGGCATGGCTGGGAGAAGG - Intronic
932462632 2:71893219-71893241 GGATGGGCAGGATGTGGAGAAGG - Intergenic
932734384 2:74244397-74244419 GGGAGGGAAGGAAGGGGGGAGGG - Intronic
932817535 2:74873992-74874014 GTGTGGGCTGGAAAGGGAGAAGG + Intronic
933336745 2:80968119-80968141 GCCTGGGCATGGAGTGGAGATGG - Intergenic
933708468 2:85308469-85308491 GGGAGGGAAGGAGGGGGAGAGGG - Intronic
933730938 2:85455860-85455882 GGGTGGGGAGGAGGGGGAAATGG + Intergenic
933767952 2:85723620-85723642 GAGTGGGTATGAAGCAGAGATGG + Intergenic
933779702 2:85792965-85792987 TGATGGGCATGAAGGGGGGCAGG - Intergenic
934504641 2:94880686-94880708 GGGTGGGCAGGGAGAGCAGAGGG - Intergenic
934521329 2:95021971-95021993 GGATGGGGATGGAGGGTAGAGGG - Intergenic
934738101 2:96700220-96700242 GGGTAGGAGTGAAGGGGAAAGGG - Intergenic
935287707 2:101579911-101579933 GGGTGGGGATGACGCAGAGATGG + Intergenic
935620498 2:105125825-105125847 GGGAGGGAAGGAAGGAGAGATGG + Intergenic
935703977 2:105840055-105840077 GGTTGGGGAGGAAGTGGAGATGG + Intronic
935796438 2:106645642-106645664 GGGTGGGAAGGGAGGGGAAAAGG + Intergenic
935999357 2:108811123-108811145 GGGAGGGGAAGAAGGGAAGAAGG - Intronic
936379170 2:111968925-111968947 TGGTGGCCATGAAGGACAGAAGG + Intronic
936562358 2:113552096-113552118 GGGTGGGCATGGAGGGGAGAGGG - Intergenic
937756246 2:125542410-125542432 GGCTGAGCATGAAGGGAACAGGG - Intergenic
938114090 2:128591594-128591616 GGGAGGGCACCAAGGGGAGGTGG + Intergenic
938228193 2:129635868-129635890 GGGTGGCCATGGAGGGCGGATGG - Intergenic
938241813 2:129748099-129748121 GCCTGGGCATGAAGCAGAGAGGG - Intergenic
938308636 2:130270366-130270388 GTGAGTGCATGAAGTGGAGAGGG + Intergenic
938446697 2:131386471-131386493 GTGAGTGCATGAAGTGGAGAGGG - Intergenic
938588180 2:132712256-132712278 GGGTGGGCATAAAGGGGAAGAGG - Intronic
939167808 2:138658263-138658285 GGGGGGGGAGGAAGGGGAGGAGG - Intergenic
940166183 2:150775407-150775429 GGTTGTGCATGTGGGGGAGAAGG + Intergenic
940408453 2:153332703-153332725 GCCTGGGCATGGAGTGGAGAGGG + Intergenic
940555451 2:155221155-155221177 GGGTGGGGAGGAAGTGGAGATGG + Intergenic
940639751 2:156333488-156333510 GGGGGGAGAGGAAGGGGAGAGGG + Intronic
941650196 2:168084172-168084194 AGGTGGGCATGGTGGGGGGAAGG + Intronic
942132267 2:172892097-172892119 GGGGTGGCAGTAAGGGGAGAGGG + Intronic
942796537 2:179827159-179827181 TGATAGGCATGCAGGGGAGAAGG + Intronic
944361749 2:198865332-198865354 GGGTGGGCAGGGAGGGCAGCTGG - Intergenic
944599040 2:201284642-201284664 GGCTCGGCATGAGAGGGAGAGGG + Intronic
945410393 2:209499771-209499793 GGGTGGGGAGGAAAAGGAGAGGG + Intronic
945412507 2:209528092-209528114 GGGTGGGCAGGGGGGGAAGATGG - Intronic
945494991 2:210499125-210499147 GCCTGGGCATGAAGCAGAGAGGG + Intronic
945906295 2:215597307-215597329 GGGTGTGGAGGAAGGGCAGAGGG - Intergenic
945970607 2:216227521-216227543 GGCTCGGCATGAGAGGGAGAGGG + Intergenic
946039837 2:216774007-216774029 GGCAGAGCATGAAGGTGAGAAGG + Intergenic
946411424 2:219517100-219517122 GGGTGGGCAGGAAAGGGGAAGGG + Intronic
946773348 2:223112031-223112053 GTATGAGCATGAAGAGGAGAAGG + Intronic
947018247 2:225645407-225645429 AGGAGGGAATGAAGGAGAGAAGG - Intronic
947998010 2:234544766-234544788 GGGAGGGAAGGAAGGAGAGAGGG + Intergenic
948085762 2:235245655-235245677 TGGTGGGGACGAGGGGGAGATGG + Intergenic
948091784 2:235301725-235301747 GAGGGGGGATGAGGGGGAGAAGG - Intergenic
948209584 2:236182988-236183010 GGGAGGGAAAGAAGGAGAGAGGG - Intergenic
948265564 2:236633072-236633094 GGGTGGGCTTGATGGGGATGTGG + Intergenic
948265662 2:236633511-236633533 GGGTGGGGAGCAGGGGGAGAAGG + Intergenic
948582618 2:238998184-238998206 GGGAGGGAAGGAAGGAGAGAAGG - Intergenic
948693400 2:239720817-239720839 GGGGAGGCTTGAAGGGGAGCTGG + Intergenic
948705605 2:239790385-239790407 TGCTGGACATGAAGGGGACAGGG + Intronic
948730400 2:239959835-239959857 AGGAGGGAAGGAAGGGGAGAGGG + Exonic
948916109 2:241035794-241035816 GGTTGGGGATGAGGGGTAGATGG + Intronic
1168754980 20:310133-310155 GGGAAGGAAGGAAGGGGAGAAGG - Intergenic
1168853137 20:990149-990171 GGGTTGGCAGGGAGGGGTGACGG - Intronic
1168912186 20:1457585-1457607 GTGAGGGCATAATGGGGAGATGG - Intronic
1169025668 20:2369158-2369180 GGGTGGGCAGGGTGGGGGGAGGG - Intergenic
1169267677 20:4176589-4176611 GGATGGGGAGGAATGGGAGAAGG + Intronic
1169515552 20:6312369-6312391 GCCTGGGCGTGAAGTGGAGAGGG - Intergenic
1169950094 20:11034348-11034370 TGGTTGACATAAAGGGGAGATGG + Intergenic
1170125981 20:12964823-12964845 GGTAGGGCATGAAGGGTGGATGG + Intergenic
1170335581 20:15267168-15267190 GAGTGGGGATGCAGAGGAGAGGG - Intronic
1170464659 20:16611661-16611683 GAGTGAGCAGGAAGGGAAGATGG + Intergenic
1170475876 20:16713969-16713991 GGGTGGGAATGGAGGGTGGAAGG + Intergenic
1171255976 20:23689227-23689249 GAGTGGGGAGGAGGGGGAGATGG - Intergenic
1171263324 20:23751124-23751146 GAGTGGGGAGGAGGGGGAGATGG - Intronic
1172219132 20:33260604-33260626 GGGTAGACAGGAAGAGGAGATGG + Intergenic
1173096079 20:40029688-40029710 AGGAAGGAATGAAGGGGAGAAGG + Intergenic
1173164506 20:40677176-40677198 GGGTGGGACTGCAGGGGAGGGGG - Intergenic
1173374632 20:42472341-42472363 GGATGGTCATGAAGGGGCGCAGG + Exonic
1174137869 20:48393032-48393054 GCCTGGGGATAAAGGGGAGATGG + Intergenic
1174355603 20:49995820-49995842 GGGTTGGAATGAAAGGGAGAGGG - Intergenic
1174413197 20:50349343-50349365 GGCTGGGCCTGAATGGCAGAGGG - Intergenic
1175147696 20:56909332-56909354 GGGTGGGCATGCACGGGGGCTGG + Intergenic
1175178258 20:57126820-57126842 GGGTGGGCCTGCTGGGGAGAGGG + Intergenic
1175273824 20:57753947-57753969 GAGTGGGGATGAAGGAGAGGAGG + Intergenic
1175279740 20:57795018-57795040 GAGTGGGCGTGAAGGAGAGCAGG + Intergenic
1175345263 20:58268521-58268543 GGGTGGGAATGAAGAGGAGCGGG + Intergenic
1175381524 20:58567464-58567486 TGGTGGGAATGAAGGGGACAGGG + Intergenic
1175432448 20:58915606-58915628 GGGAGGGGAGGAAGGAGAGAAGG - Intergenic
1175625299 20:60484349-60484371 GGGTGGCCATGAAAGGAAGGAGG - Intergenic
1175890592 20:62314192-62314214 GAGTGGGCATGGAGAGGTGAAGG + Intronic
1175983359 20:62752443-62752465 GGGTGGGCAGGTGGGGGAGGCGG + Intronic
1176002639 20:62839853-62839875 GTGTGTGCGTGGAGGGGAGAAGG - Intronic
1176723612 21:10412818-10412840 GGATGAGCAGGAAGGAGAGAAGG - Intergenic
1176796471 21:13374010-13374032 GGATGAGCAGGAAGGAGAGAAGG + Intergenic
1178222915 21:30681352-30681374 GGGTGAGCAGGAAGAGTAGAGGG + Intergenic
1178345633 21:31825511-31825533 AGGTGGGTGTGAGGGGGAGAAGG - Intergenic
1178994666 21:37388038-37388060 AGGAGGTCATGAAGGGAAGAGGG - Intronic
1179188791 21:39106390-39106412 GGGTGGCAATGAAGTGGAGATGG - Intergenic
1179469767 21:41602769-41602791 GGGTGGGCACGTCGGTGAGAGGG + Intergenic
1179646944 21:42781985-42782007 GGGAGAGGAGGAAGGGGAGAGGG - Intergenic
1180011684 21:45055359-45055381 GGGTGGGCCTGAAGGCGCGGGGG - Intergenic
1180048530 21:45320848-45320870 GGGAGGGCAGGAAGGGCAGGCGG + Intergenic
1180056125 21:45360068-45360090 GGGTTGGCGGGAAGGGGAGTGGG - Intergenic
1180340133 22:11611513-11611535 GGCTGGACATGAAGGGGGGCGGG - Intergenic
1181305761 22:21916467-21916489 GGGTGGGGATGGAGGTGAAAGGG - Intergenic
1181387714 22:22557900-22557922 GGGTGGGGAAGGAGGGGAGATGG + Intronic
1181598732 22:23936471-23936493 GGCTCGGCATGAGAGGGAGACGG - Intergenic
1181610477 22:24008117-24008139 TGGTGGGCAGAAAGGAGAGAAGG + Intergenic
1181808918 22:25391808-25391830 GGTTGGGCAGGAACGGGTGATGG + Intronic
1182471238 22:30549629-30549651 GGGGGGACATGAAGGGGGGAAGG - Intergenic
1182582255 22:31321293-31321315 GGGTGGGAATGCAGGAGAGGTGG - Intergenic
1182944862 22:34312349-34312371 GCCTGGAGATGAAGGGGAGAAGG - Intergenic
1183160256 22:36108552-36108574 GGGTAGGCAGGGAGGGGAGGAGG + Intergenic
1183337650 22:37259813-37259835 GGTTGGGTAGGAAGGGGAGGGGG - Intergenic
1183378114 22:37476857-37476879 GGGTGGGCAGGAAGGCGGGGAGG - Intronic
1183871890 22:40746360-40746382 GGCTCGGCATGAGAGGGAGAGGG + Intergenic
1183948296 22:41339032-41339054 TCGTGGGCGTGGAGGGGAGAAGG - Exonic
1183976546 22:41515583-41515605 TGGTGGGGATGAACGGGAGACGG + Intronic
1184031694 22:41898859-41898881 GGGTGGGCGTGTTGGGGTGAAGG + Intronic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184257421 22:43295183-43295205 AGGTGGGCATGGAGGGGCCAGGG - Intronic
1184366435 22:44054571-44054593 GGCTGGGCAGGGAGGGGACAGGG + Intronic
1184409191 22:44316859-44316881 GGGCGGGCAGGAGGGGGAGCTGG + Intergenic
1184444722 22:44540424-44540446 GGGAGTTCAGGAAGGGGAGAGGG - Intergenic
1184699332 22:46159769-46159791 TGAGAGGCATGAAGGGGAGAGGG + Intronic
1185011836 22:48318898-48318920 GGATGAGCATGAAGAGGACAGGG - Intergenic
949359997 3:3221570-3221592 TGATGGGGATGAAGGGGAGAAGG - Intergenic
950096116 3:10331678-10331700 GGGTAGGCAGGGAGGGGAGATGG - Intronic
950423503 3:12912267-12912289 GGCTGGGCTGGGAGGGGAGAGGG + Intronic
950634783 3:14307234-14307256 GGGTGGGGATGCAGGGGAGGTGG + Intergenic
951715812 3:25644700-25644722 GGGGGGGCATCAGGGGGTGATGG + Intronic
952244878 3:31576669-31576691 GGTTGGGGATTAAGGGGAGGAGG - Intronic
952758403 3:36892222-36892244 ATGAGGGCATGAAGGGGATACGG + Exonic
952815271 3:37442161-37442183 GGCGGGGCAAGAAGGGGTGAGGG - Intergenic
953134742 3:40172761-40172783 GTGGGGGAAGGAAGGGGAGAGGG - Intronic
953227694 3:41035441-41035463 GAGTGGGGAAGAAGGGGAGAAGG - Intergenic
953462836 3:43095321-43095343 GGGTGGGCATGAAGGTCCAATGG + Intronic
953563861 3:44014614-44014636 GGGTGGGGTTGAGGGGCAGATGG - Intergenic
953631909 3:44625167-44625189 GGGTGGGCGTGCAGGGAAGGCGG + Intronic
953903728 3:46857814-46857836 GGGAGGGAAGGAAGGAGAGAAGG + Intergenic
954134105 3:48574261-48574283 GGCTGGGCCTGAAGGGAAGCCGG - Exonic
954146777 3:48638358-48638380 GAGTGGGCATGAAGGGGCTGGGG - Intronic
954880621 3:53833555-53833577 AGGTGGGCAGGAATGGGAGCAGG + Intronic
954974778 3:54683061-54683083 GGGTGTGAATGAAGGGGAAGAGG - Intronic
955363548 3:58293093-58293115 GGGGTGGCATGGTGGGGAGAAGG - Intronic
955588407 3:60507326-60507348 GGCTGGGCATGAAAGAAAGAGGG + Intronic
956218550 3:66877151-66877173 GGGAGGGCAAAAAGGGGAAAAGG + Intergenic
956468668 3:69542707-69542729 GGGAGGGAAGGAAGGGGAGGGGG + Intergenic
956788526 3:72662398-72662420 GGGTGGGCATGATGGGGGGAGGG - Intergenic
956839184 3:73121186-73121208 GGTAGGACATGAAGGGGAGGTGG + Intergenic
957938701 3:86977241-86977263 GGGAGGGAAGGAAGGAGAGAGGG + Intronic
957954483 3:87167057-87167079 GGGAGGGTATCAAGGAGAGAAGG + Intergenic
959430648 3:106251332-106251354 GCCTGGGCATGAAGTGGAGAAGG - Intergenic
960235509 3:115277561-115277583 GGGTGGGGAGGCAGTGGAGATGG - Intergenic
960415572 3:117381359-117381381 GGGAGGTCAGGAAGTGGAGAAGG - Intergenic
960591364 3:119368944-119368966 GGGTGGGTAGAGAGGGGAGAGGG + Intronic
961149770 3:124628176-124628198 GGGAGGGAATGAAGGAGGGAGGG - Intronic
961149812 3:124628288-124628310 GGGAGGGAATGAAGGAGGGAGGG - Intronic
961406036 3:126680110-126680132 GAGAGGGCAGGAAGGTGAGAAGG + Intergenic
961524949 3:127490780-127490802 GGGTGGGCATGGTGGGGGTAGGG - Intergenic
961762649 3:129183339-129183361 GGCTGCGGATGAAGGGGGGATGG - Intronic
961865860 3:129953061-129953083 GGGTGAGGATGGAGTGGAGAGGG - Intergenic
963285619 3:143431815-143431837 GGGTGAGCATGTAGGAGAGTAGG - Intronic
963375506 3:144458574-144458596 GGGAGGGAATGAAGAGGAAAAGG + Intergenic
963609196 3:147443807-147443829 GGTTGGGAATGAAAGGGAGCAGG - Intronic
963851124 3:150211368-150211390 AGGTGGGCAGGCAGGGAAGAAGG + Intergenic
964834818 3:160926536-160926558 GGGTAGGCATTAAGGGGGGGAGG - Intronic
964919160 3:161875226-161875248 ACCTGGGCATGAAGGAGAGAGGG - Intergenic
965567968 3:170140952-170140974 GGGTGTGCCTGGTGGGGAGAAGG + Intronic
966982683 3:185152877-185152899 GGGTGGGCAGGAAGCCGAGCCGG + Exonic
967613507 3:191536792-191536814 GGGTGGGAATAAATGGGAAAAGG + Intergenic
967982391 3:195073478-195073500 TTGTGGGCATGAGGGGGGGAGGG - Intronic
968038259 3:195567051-195567073 AGGTGGGCATGGAGGGAGGAGGG - Intergenic
968287440 3:197517281-197517303 GGGTCGGCCTGAGGGGGGGATGG - Intronic
968287455 3:197517334-197517356 GGGTCGGCCTGAGGGGGGGATGG - Intronic
968287588 3:197517806-197517828 GGGTCAGCCTGAGGGGGAGATGG - Intronic
968287602 3:197517860-197517882 GGGTCAGCCTGAGGGGGAGATGG - Intronic
968287617 3:197517914-197517936 GGGTCAGCCTGAGGGGGAGATGG - Intronic
968287632 3:197517969-197517991 GGGTCAGCCTGAGGGGGAGATGG - Intronic
968287646 3:197518023-197518045 GGGTCAGCCTGAGGGGGAGATGG - Intronic
968287689 3:197518186-197518208 GGGTCAGCCTGAGGGGGAGATGG - Intronic
968287703 3:197518240-197518262 GGGTCAGCCTGAGGGGGAGATGG - Intronic
968287766 3:197518456-197518478 GGGTCAGCCTGAGGGGGAGATGG - Intronic
968287780 3:197518510-197518532 GGGTCGGCCTGAGGGGGGGATGG - Intronic
968287797 3:197518564-197518586 GGGTCAGCCTGAGGGGGAGATGG - Intronic
968423121 4:501928-501950 GAGAGAGAATGAAGGGGAGAGGG + Intronic
968441744 4:627843-627865 GGGTGGGGACAAAGGGGTGAAGG - Intronic
968697509 4:2040454-2040476 GCGTGGGACCGAAGGGGAGAAGG + Intronic
968725200 4:2244133-2244155 GGGTGGGAATGCAGGGCTGAGGG + Intergenic
968894392 4:3390191-3390213 AGGTGGTCAGGAAGGGAAGAGGG - Intronic
969036938 4:4262027-4262049 GGGTGGGGATGGAGGGCACAAGG - Intergenic
969088334 4:4673188-4673210 GCGTGGTCCTGAAGGGGACAGGG - Intergenic
969244479 4:5923583-5923605 GGGTAGGGATGGAGGGGAGAAGG + Intronic
969599149 4:8165640-8165662 GTGTGGGCATGGAAGGGATAAGG + Intergenic
969659385 4:8517701-8517723 GGTAGGGCATGCAGGAGAGAAGG + Intergenic
970451992 4:16178111-16178133 GGGTGTCCATGAAGGGCAGAGGG - Intronic
971177161 4:24292700-24292722 GGGTGGGGATGAAGGGGTTGGGG - Intergenic
971865171 4:32160520-32160542 GGGAGGGAAGGAAGGAGAGAAGG - Intergenic
972904652 4:43729673-43729695 GGGTCGGGAGGGAGGGGAGAGGG + Intergenic
973001832 4:44961404-44961426 GCGTGAGCATGGAAGGGAGAAGG + Intergenic
973555468 4:52077308-52077330 GGGAGGGAAGGAAGGAGAGAGGG - Intronic
974394136 4:61313475-61313497 GTGTGCCCATGCAGGGGAGAAGG + Intronic
974642147 4:64645060-64645082 GGGTGGAAATAAAGGGAAGATGG - Intergenic
974758354 4:66242823-66242845 GGGTGGGCGGGGAGGGGGGAGGG - Intergenic
974762841 4:66300702-66300724 AGGAGGGGAGGAAGGGGAGAGGG - Intergenic
975246941 4:72130658-72130680 GGGGGAGCATGCAGGTGAGAGGG + Intronic
976748967 4:88434527-88434549 GGTTGGGGATGGAGAGGAGATGG + Intronic
976890808 4:90045230-90045252 GGGTTGGTAGGAAGGGCAGAAGG - Intergenic
976998784 4:91468353-91468375 TGGTGTGCAGGGAGGGGAGAGGG + Intronic
977003890 4:91541369-91541391 TGGTGTGCAGGGAGGGGAGAGGG - Intronic
977090824 4:92673825-92673847 GGGTGGGGAGGAAGGGGGGAGGG + Intronic
978702338 4:111662646-111662668 GGATGGGGAGGAGGGGGAGAGGG + Intergenic
978733926 4:112063661-112063683 GGGTGGGGAAGAAGTGGGGATGG + Intergenic
978900813 4:113947532-113947554 GGGAGGGAAGGAAGGAGAGAGGG + Intronic
979505021 4:121485645-121485667 GTCTGGGCATGAAGCAGAGAGGG + Intergenic
980883537 4:138738826-138738848 GGCTGGGCATCAGAGGGAGACGG - Intergenic
981002324 4:139839819-139839841 TAGTGGATATGAAGGGGAGATGG + Intronic
981010278 4:139918321-139918343 GTGTGGTGGTGAAGGGGAGAAGG - Intronic
981603653 4:146520544-146520566 GGGTGGAGGTTAAGGGGAGAAGG + Intronic
981761642 4:148201627-148201649 GGGTTGGCAGGCAGAGGAGATGG - Intronic
982276262 4:153639768-153639790 GGGTGGGGTTGACGGGGAGTAGG + Intergenic
982292106 4:153790916-153790938 GGGGGGGCGTGAAAGCGAGAGGG - Intergenic
983158601 4:164383409-164383431 GTGTGGGCTTGAAGGGGACGGGG - Exonic
983183942 4:164679685-164679707 GGGAGGGAGGGAAGGGGAGAAGG - Intergenic
983223045 4:165061003-165061025 GAGTGGGCATCACAGGGAGAGGG + Intergenic
983387424 4:167082830-167082852 GGGAGGGAAGGAAGGGAAGAGGG + Intronic
983474288 4:168195692-168195714 GTATGGGCATGGAGTGGAGAGGG - Intergenic
984256965 4:177400869-177400891 GGGAGGGACTGAAGGGAAGATGG - Intergenic
984632159 4:182072787-182072809 GGATTGGCATGAAGATGAGATGG - Intergenic
984703091 4:182831254-182831276 GGTTAGGTATGAAGGGGGGAAGG + Intergenic
985033225 4:185813354-185813376 GGTTGGGGAGGAAGGGGAGCGGG - Intronic
985141592 4:186845536-186845558 TAGTGGACATGAAGGGGAAATGG + Intergenic
985709410 5:1419915-1419937 AAGTGGGAAGGAAGGGGAGAAGG - Intronic
985904995 5:2827454-2827476 GGGTTGGGATGTGGGGGAGATGG + Intergenic
986016204 5:3759464-3759486 GGGTTGGGGTGAAGGGGAGCTGG + Intergenic
986743550 5:10724970-10724992 AGGGGAGCCTGAAGGGGAGAGGG - Intronic
986803459 5:11285196-11285218 GAGGGGGCCTCAAGGGGAGATGG - Intronic
987009911 5:13751856-13751878 GGGTGGGGCAGAAGGGGAGAGGG + Intronic
987169308 5:15237782-15237804 GGGTGAGGATGAGTGGGAGAAGG - Intergenic
987589150 5:19900235-19900257 GGGAGGGGAGGAAGGAGAGAGGG + Intronic
987695248 5:21320441-21320463 GGGAGGGAATGAGGGAGAGAGGG - Intergenic
988185901 5:27861612-27861634 GTGTGTGCATGAAGGGAAGGGGG - Intergenic
988680684 5:33481173-33481195 GAGGGGGAATGAAGGGGAGGGGG - Intergenic
989120312 5:37998250-37998272 GCTGAGGCATGAAGGGGAGACGG + Intergenic
989333525 5:40287986-40288008 GGGTGGGCTTGAAAGGAAGGTGG - Intergenic
989574594 5:42978727-42978749 GGCTGGGCATCAGAGGGAGACGG - Intergenic
990202554 5:53394482-53394504 GGGTGGGGGAGAAGTGGAGATGG - Intergenic
990379502 5:55208009-55208031 AGGTGGGCAAGAGGAGGAGAAGG + Intergenic
990854560 5:60249254-60249276 GTGTGGGCATGAGAGGGAAATGG - Intronic
990903291 5:60776720-60776742 GGGAGGGAAGGAAGGGGACAAGG + Intronic
990976342 5:61564854-61564876 CTTTGGGAATGAAGGGGAGAAGG - Intergenic
991169000 5:63599129-63599151 GGGAGGGCAGGAGGGAGAGATGG - Intergenic
992334472 5:75751465-75751487 GGTTGGGGTTGGAGGGGAGAGGG + Intergenic
993453189 5:88097597-88097619 GGGTGGGCGTGAAGGTCAGCAGG - Intergenic
994399725 5:99264072-99264094 GCCTGGGCATGGAGTGGAGAGGG - Intergenic
995365274 5:111352669-111352691 GGGAGGGAGGGAAGGGGAGAGGG + Intronic
995495790 5:112741483-112741505 GTGTGAGAATAAAGGGGAGAAGG - Intronic
996833072 5:127761069-127761091 GAATGGGCTTGAAGGGGAGCAGG - Intergenic
997046728 5:130328239-130328261 AGGAGGGCATAAAGAGGAGATGG - Intergenic
997079329 5:130719562-130719584 GGGAGGGTGTGAGGGGGAGAGGG + Intergenic
998160238 5:139809061-139809083 AGGTGGGGAGGAAGTGGAGAAGG - Intronic
998243163 5:140469110-140469132 GGGTGGGAGAGAAGGAGAGAAGG - Intronic
998326012 5:141280420-141280442 GGGTGGGGTGGTAGGGGAGAGGG - Intergenic
998885881 5:146693115-146693137 GGGAGGGAAGGAAGGAGAGAGGG - Intronic
999214017 5:149916430-149916452 TGGTAGGCATGAAGGAGAAATGG - Intronic
999320418 5:150611553-150611575 GGATGGGCATGAGGTGGAGCTGG - Intronic
999585834 5:153088640-153088662 GTGTGGAAATGAAGGGTAGATGG + Intergenic
999675724 5:154000213-154000235 GGGTGGGGATGAAGAGAAGTTGG + Intronic
999889374 5:155960152-155960174 AGGTGGAAATGAAGAGGAGAAGG - Intronic
999946362 5:156600305-156600327 GGGAGGGGATGGAGGAGAGAAGG - Intronic
1000107846 5:158077603-158077625 GGCTGGGAAGGAGGGGGAGAGGG - Intergenic
1000185277 5:158851967-158851989 GGGTGGGGAGGAGGGGGAGAAGG + Intronic
1000186212 5:158860739-158860761 GGCTTGGACTGAAGGGGAGAAGG - Intronic
1000463268 5:161547662-161547684 GGGTTTGCATGAGGGGGAGATGG + Intronic
1000647321 5:163774191-163774213 GGATGGGGATGAAAGGGAGGTGG + Intergenic
1000942483 5:167379044-167379066 GGGTGGACATGGAGAGGGGAGGG - Intronic
1000946432 5:167427831-167427853 GGGAGGGAAGGAAGGGAAGAAGG + Intronic
1001082388 5:168676905-168676927 GGGATGGCAGGAAGGGAAGAAGG - Intronic
1001629982 5:173167907-173167929 GGGTGGGTATGGGCGGGAGATGG - Intergenic
1001651739 5:173320633-173320655 GGGCGGGCAGGAAGGGGTGAGGG + Intronic
1002203691 5:177547839-177547861 GGTGGAGAATGAAGGGGAGATGG + Intronic
1002526691 5:179819311-179819333 GGGGGGGCGGGGAGGGGAGAAGG - Intronic
1002723561 5:181280771-181280793 GGATGAGCAGGAAGGAGAGAAGG - Intergenic
1003161757 6:3641667-3641689 AGGTGGGGGTGAAGGGGATAGGG + Intergenic
1003175439 6:3750411-3750433 GGGAGGGCCGGGAGGGGAGAAGG - Intronic
1003286051 6:4734681-4734703 GGATGGGGATGGAGGGAAGATGG + Intronic
1003418161 6:5931762-5931784 AGGTGGGCAGGAGAGGGAGAAGG - Intergenic
1003487863 6:6595283-6595305 AGGTGGGGAAGAAGAGGAGAAGG + Intronic
1004248997 6:14007051-14007073 GGGTGGGGAGGAAAGGGAAAGGG - Intergenic
1004280457 6:14275704-14275726 GGGTGGGGGTGAAGGCGAGGAGG + Intergenic
1004305921 6:14501981-14502003 AGGTGGACAGGAAGAGGAGAAGG - Intergenic
1004895253 6:20141799-20141821 CGGTGGGCATGAAGGGCAGCGGG + Intronic
1004989307 6:21119089-21119111 TGGTCGGGACGAAGGGGAGAGGG - Intronic
1005669623 6:28092051-28092073 GGGATGGCATGAAGGAGAGGAGG - Intergenic
1005837034 6:29717928-29717950 GGCTCGGCATGAGAGGGAGAGGG - Intergenic
1005898335 6:30196750-30196772 CAGGGGGCAGGAAGGGGAGAAGG + Intronic
1005951368 6:30633798-30633820 GGGTGGGGAGAAAGAGGAGAAGG + Intronic
1005990588 6:30899465-30899487 GTGTGTCCAGGAAGGGGAGAAGG - Intronic
1006131892 6:31874654-31874676 GGGTGGGCACGAGAGGGAGGGGG - Intronic
1006368947 6:33632788-33632810 GGCTGGTCCTGGAGGGGAGAAGG + Intronic
1006378603 6:33685081-33685103 GAGTGGGCATGATGGGGGCAGGG + Intronic
1006832916 6:36979641-36979663 GGGTGGGCTGGAAGGAGAGGAGG + Intronic
1006971450 6:38049889-38049911 GGGTGGGTGTGAGGGGGAGGGGG - Intronic
1007125602 6:39423183-39423205 GGCTGGGCTTGGAAGGGAGAAGG + Intronic
1007277878 6:40689046-40689068 GGATGGGAATGGTGGGGAGATGG - Intergenic
1007401022 6:41602403-41602425 GGGAGGGGAAGAAGGGGAAAGGG - Intergenic
1007520960 6:42451752-42451774 CGGAGGGCAGGAAGGGGAGCAGG - Intronic
1007556204 6:42768661-42768683 CACTGGGCATGGAGGGGAGAAGG - Intronic
1007697865 6:43744941-43744963 GGGGAGGCATGAAAGGGAGCTGG + Intergenic
1007841584 6:44720454-44720476 GGGTGGGGGTGAGGGGTAGATGG + Intergenic
1007916114 6:45563199-45563221 GGTTGGGGAGGAAGGGGGGAGGG - Intronic
1007936940 6:45740885-45740907 GGCTGGGCAGAAAGGGGAGCAGG + Intergenic
1008427745 6:51379370-51379392 GGGAAGGAAGGAAGGGGAGAGGG + Intergenic
1008612761 6:53199363-53199385 GGGTAAGAATGCAGGGGAGAGGG + Intergenic
1008740554 6:54602450-54602472 TGGTGGGCAGAAAGAGGAGAGGG + Intergenic
1008926783 6:56895982-56896004 GGCTCGGCATGAGAGGGAGAGGG + Intronic
1008936608 6:56999283-56999305 GCCTGGGCATGAAGCAGAGATGG - Intronic
1009656911 6:66558847-66558869 GCCTGGGCATGGAGTGGAGAGGG + Intergenic
1010058400 6:71591283-71591305 GGGTTTTCATGAAGGAGAGAAGG + Intergenic
1010086015 6:71918907-71918929 GGCTGGGCAAGAAAGAGAGAAGG + Intronic
1011151713 6:84281166-84281188 AGGTAGTCAGGAAGGGGAGATGG - Intergenic
1011487556 6:87858380-87858402 TGGTCAGCATGAAGGTGAGAGGG + Intergenic
1011785783 6:90843112-90843134 GGGTGGGGGTGGAGTGGAGATGG + Intergenic
1012365141 6:98429781-98429803 GGGTTGGCAAGAAGGGTAGGGGG - Intergenic
1012398948 6:98828830-98828852 GGGTGGGCGGGGAGGGGAGCAGG - Intergenic
1012573544 6:100761896-100761918 GGGTGGGAATAAAGGGTAGTTGG - Intronic
1013048422 6:106510295-106510317 AGGTGGGCAGGAAGAGGAGGAGG - Intergenic
1013127410 6:107197780-107197802 GAGAGAGCATGAAGAGGAGATGG - Intronic
1013338862 6:109193115-109193137 GGGAGGGAGTGAAGGGGAGTAGG - Intergenic
1014419628 6:121226752-121226774 GTATGGTCACGAAGGGGAGAAGG + Intronic
1014764406 6:125390092-125390114 GGCTCGGCATGAGAGGGAGAGGG + Intergenic
1015306554 6:131715406-131715428 GCCTGGGCATGAAGTGGAGATGG - Intronic
1015461463 6:133496476-133496498 GGGTGGTCATGTAGGGGAAATGG - Intronic
1015614693 6:135062801-135062823 GGCTGGCCAAGAAGGGAAGATGG - Intronic
1015678090 6:135772891-135772913 GGTGGGGAATGAAGGTGAGACGG - Intergenic
1016278308 6:142380807-142380829 AGGGAGGCATGAAAGGGAGATGG - Intronic
1016540098 6:145154702-145154724 GGGTGGGAACCAAGGTGAGAGGG + Intergenic
1017637362 6:156456196-156456218 GAGGGGGGAGGAAGGGGAGAGGG - Intergenic
1017637433 6:156456331-156456353 GGGAGGGGAGGAAGGGGAGAAGG - Intergenic
1018732156 6:166659379-166659401 GGGTGGCCGGGGAGGGGAGAGGG + Intronic
1018816803 6:167338982-167339004 GGGAGGGCAGGAAGGAGGGAGGG - Intronic
1018868318 6:167762093-167762115 GGGTGGAGATGAAAGGTAGAGGG - Intergenic
1019085253 6:169469437-169469459 GGCAGGGCATGAAGCTGAGAGGG - Intronic
1019126003 6:169840403-169840425 GGGTGGGCATGGCGTGGAGTGGG - Intergenic
1019126021 6:169840473-169840495 GAGTGGGCATGATGTGGAGTGGG - Intergenic
1019414118 7:919726-919748 GGGTGGGAGAGACGGGGAGAGGG + Intronic
1019496631 7:1343659-1343681 GGGTGGGCATGGCGGGGACCAGG - Intergenic
1019981189 7:4623379-4623401 GGCTCGGCATGAGAGGGAGACGG - Intergenic
1020129040 7:5549139-5549161 GGGAGGGAAGGAAGGGAAGAAGG + Intronic
1020154429 7:5710724-5710746 GGGTGGGAGTGGAGTGGAGATGG - Intronic
1020426715 7:8074940-8074962 GGATAGACATGGAGGGGAGAGGG + Intronic
1022089208 7:27096684-27096706 GGGTGGGCGTGAAGGAGACGAGG + Intergenic
1022307143 7:29157324-29157346 GGCTGGGCATTGAGTGGAGAAGG - Intronic
1022317654 7:29260530-29260552 GGGTGGCCATGGTGGGGCGAGGG + Intronic
1022468857 7:30669460-30669482 GGGTGGGCTTGCAGGTGGGAGGG + Intronic
1022831374 7:34070514-34070536 GGGTGTGCAAAAAGGGGTGAAGG - Intronic
1022971118 7:35518230-35518252 GAGTGGCCATGAAGGGGTGGTGG + Intergenic
1022993886 7:35733974-35733996 GGATGGGTAAGAAGGGGGGAAGG + Intergenic
1023283696 7:38596475-38596497 GGGAGGACATGAAAGGGAGAGGG + Intronic
1023935560 7:44737522-44737544 AGGTGGGCAGGGAGGAGAGAAGG - Intergenic
1024352086 7:48376893-48376915 GGGCAGGCATGAGGGGGTGAGGG + Intronic
1024486781 7:49928487-49928509 GGGTGGTCCTGAAGGAGAGTGGG - Intronic
1025085596 7:56020702-56020724 GGGAGGGCAGGAGGGAGAGAGGG + Intronic
1025957360 7:66193225-66193247 GGGAGGGAAGGAAGGAGAGAGGG + Intergenic
1026829071 7:73600490-73600512 GTGTGGGCAAGAGGGGGATACGG + Intronic
1026871723 7:73856895-73856917 GGCTTGGCAGGAAGGGGAGAAGG + Intergenic
1026968395 7:74454213-74454235 GGGTGGGGGAGAAGGGGAGAAGG - Intronic
1027233722 7:76286002-76286024 GGGTGGGCATCCAGTGGACAAGG + Exonic
1027495134 7:78878771-78878793 GCCTGGGCATGGAGTGGAGAAGG - Intronic
1027815078 7:82958372-82958394 GGGAGGGAAGGATGGGGAGAGGG - Intronic
1028224194 7:88231006-88231028 GGGTGGGTATGTATGGGTGAAGG - Intergenic
1028413484 7:90556129-90556151 AGGTGGGAAGGAAGGGGACAAGG + Intronic
1029419815 7:100466791-100466813 GGCTGGGGATGATGAGGAGATGG + Exonic
1029675310 7:102064591-102064613 TGGGGGGCATGAAGGTGAGCAGG + Intronic
1029930533 7:104365843-104365865 GTGTGGGCGGGGAGGGGAGATGG + Intronic
1030170404 7:106596169-106596191 GGATGGGAAGGAAGGAGAGAGGG + Intergenic
1031237652 7:119197189-119197211 GCCTGGGCATGAAGTGGAGAAGG - Intergenic
1031243068 7:119270628-119270650 GCCTGGGCATGAAGCAGAGAAGG + Intergenic
1032190694 7:129763954-129763976 GGGTGGGCAAGGAGGGAGGATGG - Intergenic
1032244496 7:130198063-130198085 GGGTGGGAAGGAAGGAGAAAAGG - Intronic
1032308043 7:130755173-130755195 AGGTGGGAATGGAGGGGAAATGG - Intergenic
1032901327 7:136312280-136312302 GTGTGGGTGGGAAGGGGAGAAGG - Intergenic
1033263690 7:139865919-139865941 GGGAGGGAAGGAAGGGAAGAAGG + Intronic
1033396226 7:140976396-140976418 GGGTGGGAATGGAGGAGACAGGG - Intergenic
1033644058 7:143287658-143287680 GGGTTGGTATGAAGGCCAGAAGG + Exonic
1033679813 7:143583347-143583369 GCCTGGGCAAGAAGTGGAGATGG - Intergenic
1033692022 7:143746096-143746118 GCCTGGGCAAGAAGTGGAGATGG + Intergenic
1033730995 7:144179094-144179116 GCCTGGGCATGAAGTGGAGATGG + Intergenic
1033969800 7:147025379-147025401 GGGAGGGGAGGAAGGGGAGGGGG + Intronic
1034070049 7:148175825-148175847 GGATGGGGAGGAGGGGGAGAAGG - Intronic
1034104313 7:148477329-148477351 GGGTGAGGATAATGGGGAGAAGG + Intergenic
1034158535 7:148975342-148975364 GGGTCAGGATGAAGTGGAGAAGG + Intergenic
1034260816 7:149754164-149754186 GAGAGGGCTTGAAGGGGAGCCGG - Intergenic
1034337538 7:150333185-150333207 GGGTGAGGATGAAAGGAAGAGGG + Intronic
1035277345 7:157755728-157755750 GAGGGGGTAGGAAGGGGAGAGGG + Intronic
1035961132 8:4139586-4139608 GAGTGGGCATCAAGGGGACAAGG + Intronic
1035992721 8:4510627-4510649 AGGAGGGAAGGAAGGGGAGAGGG - Intronic
1038205422 8:25459828-25459850 GGATGGGAAGGAAGTGGAGATGG + Intronic
1038285341 8:26201395-26201417 TGGTCAGCAGGAAGGGGAGATGG - Intergenic
1038325507 8:26569774-26569796 GCATGGGCAAGAAGGAGAGATGG + Intronic
1038495511 8:27999391-27999413 AGGTGGGCATGGGGGTGAGAGGG - Intergenic
1038740254 8:30211053-30211075 GGGTGGGCGTGGAAGGCAGAGGG - Intergenic
1039010805 8:33090751-33090773 GTGTGGGCATGAAGGGATAAGGG + Intergenic
1039395963 8:37225368-37225390 GGATGGACAGGCAGGGGAGAAGG - Intergenic
1039437940 8:37573527-37573549 GGGTGGGGCTGAAGAAGAGAGGG - Intergenic
1039547206 8:38418813-38418835 GGGTGGGCACACAGGGGACAAGG + Intronic
1040668395 8:49658182-49658204 GGGAAGGCATCAAGGGTAGAGGG + Intergenic
1040975692 8:53191921-53191943 ATGTGTGCATGAGGGGGAGATGG - Intergenic
1041095403 8:54344285-54344307 GGCTGGGCACGGTGGGGAGATGG + Intergenic
1041100996 8:54396347-54396369 GTGTGGGCATTGCGGGGAGAAGG + Intergenic
1041166603 8:55098488-55098510 GGGGGGGCATGAAGGGGTTAAGG + Intergenic
1041313656 8:56540415-56540437 CGATGGACATGCAGGGGAGAGGG + Intergenic
1041875611 8:62683713-62683735 GGGTGGGGCAGAAGGAGAGAGGG - Intronic
1041985135 8:63912831-63912853 GGGTGGGCAGACTGGGGAGATGG - Intergenic
1042032007 8:64486560-64486582 GGGAGGACAAGAAGGAGAGATGG + Intergenic
1042163246 8:65919788-65919810 GGGTGGGGAGGAAGTGGGGATGG + Intergenic
1043178202 8:77048137-77048159 GGGTGGGGAGAAAGGGGAGGGGG + Intergenic
1043965346 8:86468862-86468884 GGGAAGGGAAGAAGGGGAGAAGG - Intronic
1044308565 8:90666168-90666190 TGCTGGGCATGGAGCGGAGACGG + Intronic
1044462053 8:92457191-92457213 GGGTGGGAAGGGAGGGGAAAAGG + Intergenic
1044554019 8:93542476-93542498 GAGTGAGTTTGAAGGGGAGAGGG + Intergenic
1044942117 8:97354053-97354075 GGGTGGGTGTGAAGGGGATTTGG - Intergenic
1044996683 8:97844097-97844119 GGGGGAGCAGGATGGGGAGAGGG + Intronic
1045795331 8:106037330-106037352 GGGTGGGCAGGAGGGAGAGGCGG - Intergenic
1047463948 8:125094133-125094155 TATTGGGTATGAAGGGGAGAAGG + Intronic
1047798664 8:128285588-128285610 GGGAGGGGAAGAAGAGGAGAGGG + Intergenic
1048449850 8:134523678-134523700 GGGAGAGAATGAAGGCGAGAGGG - Intronic
1049102793 8:140591039-140591061 GGGTCGGAATGAAGGAGGGAAGG + Intronic
1049122025 8:140747657-140747679 GGAGGGGGAGGAAGGGGAGAAGG + Intronic
1049452634 8:142670189-142670211 GCGCGGGCAGGGAGGGGAGAGGG + Intronic
1049513784 8:143043086-143043108 GGGTAGGCCTGCGGGGGAGAGGG + Exonic
1049600643 8:143505852-143505874 GGGTGGGCAGGAGGTGGAGCAGG - Intronic
1049660701 8:143818596-143818618 GGGTGGGCCAGGAGGGGAGTGGG - Intronic
1049674027 8:143881846-143881868 GGGGGAGGAGGAAGGGGAGAAGG + Intergenic
1049890326 9:63236-63258 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1050306231 9:4308438-4308460 GGGTGGCAACGAAGAGGAGAAGG + Intronic
1050619121 9:7434154-7434176 GCCTGGGCATGAAGCAGAGACGG + Intergenic
1050889253 9:10803088-10803110 GGGTGGGGATTACGGTGAGAGGG + Intergenic
1050933796 9:11366903-11366925 GCGTGGGCAGAGAGGGGAGAGGG + Intergenic
1052342460 9:27377454-27377476 GGGGTGGGAGGAAGGGGAGAAGG + Intronic
1052434712 9:28411505-28411527 TGGTTGGCAGGAAGGGGAAATGG - Intronic
1052475700 9:28956638-28956660 GGGAGGGAAAGAAGGGAAGAAGG - Intergenic
1052518917 9:29518177-29518199 GAGTGGGAAGGGAGGGGAGATGG - Intergenic
1052802450 9:32982083-32982105 GGGGGGGCATGATGTTGAGATGG - Intronic
1053329232 9:37188640-37188662 GGGAGGGGAGGAAGGGGAGGGGG - Intronic
1053731791 9:41064421-41064443 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1053885765 9:42644321-42644343 GGATGAGCAGGAAGGAGAGAAGG - Intergenic
1054224783 9:62451770-62451792 GGATGAGCAGGAAGGAGAGAAGG - Intergenic
1054696667 9:68367299-68367321 GGGTGGGCATGAAGGGGAGAGGG - Intronic
1055241923 9:74196875-74196897 GGCTGGGCATCAGAGGGAGACGG - Intergenic
1055471627 9:76617684-76617706 GGCTGGGCATGGAGGAGGGAGGG - Intronic
1055736531 9:79336610-79336632 GCCTGGGCATGAAGCAGAGAGGG + Intergenic
1056136269 9:83632189-83632211 GAGTGGGAATGGCGGGGAGATGG - Intronic
1057130530 9:92651389-92651411 GGGTGGGGATGGAGGAGAAAGGG + Intronic
1057275329 9:93673314-93673336 AGATGGGCATGGAGAGGAGACGG - Intronic
1057319153 9:93996321-93996343 TGGTGGTTATGAAGGGGAAATGG - Intergenic
1057337519 9:94166888-94166910 GGGTTGGGATGAAGGAGGGAAGG + Intergenic
1057483449 9:95463356-95463378 GGGTGAGCGTGGAGGGGAGACGG + Intronic
1057611724 9:96550207-96550229 AGGTGGGTAGGAAGGGAAGAGGG - Intronic
1057730412 9:97603387-97603409 GTGTGAGTATGAAGGAGAGAGGG - Intronic
1057867953 9:98696306-98696328 GGCTGGGCCTGAAGAAGAGAGGG + Intronic
1057912794 9:99033389-99033411 GGGTGGGAGGGGAGGGGAGATGG + Intronic
1057969621 9:99541934-99541956 GGGTGAGCATGAAGAAGAGGAGG - Intergenic
1058287118 9:103192014-103192036 GGGTGGGAATGAAGAGAAGCTGG + Intergenic
1059340503 9:113595020-113595042 GGATGGGGGCGAAGGGGAGAGGG - Intronic
1059394421 9:114025209-114025231 AGGTGGAGATGAATGGGAGATGG - Intronic
1059487990 9:114642186-114642208 GGGTGGGGAGGAAGGAGGGAAGG - Intronic
1059560726 9:115332401-115332423 GGGAGGGCAAGAAGGGGATAAGG - Intronic
1060025605 9:120168228-120168250 GGGTGGGTATGCAGAGAAGAGGG - Intergenic
1060209329 9:121700213-121700235 TGGTGGGGCAGAAGGGGAGAGGG + Intronic
1060229630 9:121817270-121817292 ATGTGGGAATGAAGGGGAGGTGG + Intergenic
1060312448 9:122474603-122474625 GGGAAGGCATGAAGGAGAGGGGG + Intergenic
1060353553 9:122881668-122881690 GGGTGGGGATGGAGAGGACAGGG + Intronic
1060383228 9:123197244-123197266 GGGTGGGGAAGAAGTGGAGATGG + Intronic
1060840950 9:126792861-126792883 GAGGGGGCATGAAGGGGTCAAGG - Intergenic
1061133354 9:128720429-128720451 GGGTAGGCACGAAGGGGGGCTGG - Exonic
1061549491 9:131325170-131325192 GGGCAGGAAGGAAGGGGAGATGG - Intergenic
1061839191 9:133347881-133347903 GGGTGGGGATGGAGGGGGGGTGG - Intronic
1062035061 9:134379313-134379335 GGGTGGGGATGAAGGAGGGCTGG + Intronic
1062144055 9:134979094-134979116 GGGAGGGGAGGAAGGAGAGAGGG + Intergenic
1062194143 9:135263909-135263931 GAGAGGGCAGGAGGGGGAGAGGG - Intergenic
1062605815 9:137348490-137348512 GGGTGGGGATCACGGGGAGGGGG + Intronic
1062605856 9:137348630-137348652 GGGTGGGGATCATGGGGAGGGGG + Intronic
1062605915 9:137348795-137348817 GGGTGGGGATCACGGGGAGGGGG + Intronic
1062606348 9:137350450-137350472 GGGTGGGGATCACGGGGAGGGGG + Intronic
1062606424 9:137350695-137350717 GGGTGGGGATCACGGGGAGGGGG + Intronic
1203772805 EBV:58084-58106 GGATGGGGATGAAGAGGGGAGGG + Intergenic
1185621734 X:1454084-1454106 GGGTGGGAAGGGCGGGGAGATGG + Intergenic
1185712389 X:2314412-2314434 GGGAAGGAAGGAAGGGGAGAAGG + Intronic
1185801689 X:3016959-3016981 GGGTTGGCAGGGAGTGGAGAGGG + Intronic
1186107097 X:6219393-6219415 GGGAGGGAATGAAGGAAAGAAGG - Intronic
1186808715 X:13166131-13166153 GGGGTGGCATGTAGGGAAGATGG - Intergenic
1187258313 X:17661413-17661435 GGGTGGGGGGCAAGGGGAGAGGG - Intronic
1187471530 X:19574015-19574037 GGGTGGGCTTGGAGTGGAGATGG + Intronic
1187882910 X:23862937-23862959 GGGAGGGCAGGGAAGGGAGAAGG + Intronic
1188265878 X:28073755-28073777 GGGTGGGGAGGAAGTGGGGATGG - Intergenic
1188473868 X:30569345-30569367 GTGTGGGTATGTAGGGGAAATGG + Intronic
1188747376 X:33862751-33862773 GGGTGGGTGTGGAGGGGAGGTGG - Intergenic
1189286105 X:39853600-39853622 GGGTGGGGAAGGAGAGGAGAAGG + Intergenic
1189667357 X:43370969-43370991 GGGAGGGAGAGAAGGGGAGAGGG + Intergenic
1190337297 X:49270127-49270149 GGATGGGGATGAAGGGGAGGAGG + Exonic
1190379922 X:49829500-49829522 GGAGGGCCATGAAGGGGAGGAGG + Intronic
1190490516 X:50978346-50978368 AGGTGGGCATGTAAGGGAGAGGG + Intergenic
1190915632 X:54809288-54809310 AGCTGAGCCTGAAGGGGAGAAGG - Exonic
1191044681 X:56122990-56123012 GGGTGGGCAGGGAGTGGAAAAGG - Intergenic
1191726826 X:64290599-64290621 TGGTGGGTATGAGGGGGAGGTGG - Intronic
1191774067 X:64793352-64793374 GCTTGGGCATGGAGTGGAGAGGG - Intergenic
1192106830 X:68325896-68325918 GGCTCGGCATGAGAGGGAGATGG - Intronic
1192560312 X:72123884-72123906 TGGCAGGCAGGAAGGGGAGAGGG + Intergenic
1192848051 X:74925725-74925747 TGGTGGGGAAGAAGGGTAGAGGG - Intergenic
1193536272 X:82719281-82719303 GGGTTGGCAGGAAGGAGTGATGG - Intergenic
1194768773 X:97874849-97874871 GGGTGGGCAGGAATGTGTGATGG + Intergenic
1194832135 X:98636557-98636579 GAGTGGGCATGAGGGAAAGAGGG - Intergenic
1194923554 X:99796317-99796339 GCCTGGGCATGGAGTGGAGAGGG + Intergenic
1195455080 X:105059251-105059273 GGGTGGGGTGGAAGTGGAGATGG - Intronic
1195636702 X:107125105-107125127 GGGTGAGGAGGAAGAGGAGAGGG - Intronic
1195734777 X:108001022-108001044 GCCTGGGCATGAAGCAGAGAGGG - Intergenic
1195879413 X:109576748-109576770 GGGCAGGTTTGAAGGGGAGATGG - Intergenic
1195968075 X:110447450-110447472 GTGTGGGGATGTAGGGGAGATGG + Intronic
1196528142 X:116751001-116751023 GCCTGGGCATGAAGTAGAGAGGG + Intergenic
1196856471 X:119989993-119990015 GGGTGAGGATGGAGGGAAGACGG + Intergenic
1197031675 X:121823888-121823910 GCATTGGCATGAAGTGGAGAGGG - Intergenic
1197246828 X:124174634-124174656 GAGAGGGCAGGAAGGGGCGAGGG - Intronic
1197536829 X:127700051-127700073 GGGTGGGAAGCATGGGGAGAGGG + Intergenic
1197976847 X:132174865-132174887 GAGTGGGCATAGAAGGGAGATGG + Intergenic
1199982234 X:152927523-152927545 GGATGGGCTTGAAGTGGAGGTGG - Intronic
1200118394 X:153779190-153779212 GGGTGGGCTGGCAGGGGAGGTGG - Exonic
1201427287 Y:13866415-13866437 GTGTGGGAATGAAGGAGACATGG + Intergenic
1201766784 Y:17579895-17579917 GGGTGGGCATGAGCGGGCCAGGG + Intergenic
1201834769 Y:18326090-18326112 GGGTGGGCATGAGCGGGCCAGGG - Intergenic