ID: 1054699688

View in Genome Browser
Species Human (GRCh38)
Location 9:68400511-68400533
Sequence CTGTTGGGGTGGAGGGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 588
Summary {0: 2, 1: 0, 2: 3, 3: 62, 4: 521}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054699688 Original CRISPR CTGTTGGGGTGGAGGGAACA TGG (reversed) Intronic
900358420 1:2275877-2275899 CTGGTGGGGTGGAGGCAACGGGG - Intronic
900407782 1:2500022-2500044 CTGTAGGGGTGGAGGCTGCAAGG - Intronic
900607628 1:3530958-3530980 CTGCTAGGCTGGAGGGAGCAGGG - Intronic
901199605 1:7459141-7459163 CTGCTGGGGAGGAAGGAGCAAGG + Intronic
901293904 1:8146050-8146072 CTGTTTGGCTTGAGGGAATACGG + Intergenic
901451219 1:9338031-9338053 CAGCTGGGGTGCAGGGAAGAGGG + Intronic
902132316 1:14273070-14273092 TTGTTGGGCTGGATGAAACACGG + Intergenic
902622698 1:17659622-17659644 CTGGTGGTGTGGAGGGTCCAGGG + Intronic
902727448 1:18346684-18346706 CCGTTGGGGTGGAGAGGCCAGGG + Intronic
902997843 1:20240913-20240935 TTGTTGGGATAGAGGCAACATGG + Intergenic
904037511 1:27566806-27566828 CTGCTAGGGTGGGGGGAAGAAGG + Intronic
904229744 1:29058670-29058692 CTGAGGGGGTGGAGGGAAAGAGG - Intronic
904400276 1:30252271-30252293 CCGATGGGGTGGAGGTAGCACGG + Intergenic
905180112 1:36160315-36160337 CTGGGAGGGTGTAGGGAACATGG + Intronic
905408541 1:37753354-37753376 CAGTCGGGGAGGAGGGAACCAGG + Intronic
905452902 1:38068453-38068475 CTGGTGGGAGGGAGGGAGCAAGG + Intergenic
907011653 1:50968922-50968944 CTGTAGGGGTGAAAGGAGCAGGG + Exonic
907082767 1:51639517-51639539 GAGTTGGGGTGGTGGGGACAAGG + Intronic
908359242 1:63351611-63351633 CTGTTGGGGGGTAGGGGGCAAGG - Intergenic
908975233 1:69888766-69888788 CTGTTTGGGGGTAGGGAAGATGG + Intronic
910542655 1:88378645-88378667 CTGAGGGGGAGGAGGGAACATGG - Intergenic
910884795 1:91953096-91953118 ATGTTGGGGTGGAGGGAGGGGGG - Intronic
911265825 1:95742499-95742521 CTGTTCCGGTGGAGGTAGCAGGG + Intergenic
912151062 1:106859205-106859227 CTGTTGGGGGGTAGGGAACTAGG + Intergenic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
915226924 1:154418484-154418506 ATGTGGGGGAGGAGGGAGCAGGG + Intronic
915384490 1:155477510-155477532 CTCTTGGGGTGGTGGGGGCAGGG + Intronic
915485028 1:156214252-156214274 GTGCTGGGGTGGTGGGATCATGG - Intronic
915490488 1:156247653-156247675 CTGCTGGGGTGCAGGGACTAGGG - Intronic
916495484 1:165342910-165342932 CTGTTGGGGAAGAGGAAACTGGG - Intronic
916769149 1:167891325-167891347 CTGTTGTGTTGGAGAGAAGAGGG - Intronic
917007591 1:170432412-170432434 CTGTTGGGGGGTGGGGGACAAGG + Intergenic
917172260 1:172190155-172190177 CGGTGGGGGTGCAGGGAAAAGGG - Intronic
917210874 1:172630854-172630876 ATGTTGGGGAAGGGGGAACAAGG + Intergenic
918429454 1:184443872-184443894 CTGCTGGGGAGGAGGTAAGAAGG + Intronic
919052087 1:192524034-192524056 ATGTTAGGGTGCAAGGAACATGG + Intergenic
919849745 1:201664684-201664706 CTGGTTGGTTGGAGGAAACATGG + Intronic
920372817 1:205490207-205490229 CTGTTGGGCTGGTGGCATCAGGG + Intergenic
920507258 1:206525305-206525327 GTGTTTGGGAGGAGGGCACAGGG + Intronic
920973050 1:210758753-210758775 CTGTTGGGGCTCAGGGAGCATGG + Intronic
921881568 1:220260589-220260611 CTGTTGGGGTGGTGGGGGGAGGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924421599 1:243915016-243915038 CTGTGGGGGCTGAGGGACCAAGG - Intergenic
924828477 1:247567324-247567346 CTGTTGGGGTGTGGGGGGCAAGG - Intronic
924909574 1:248496517-248496539 ATGCTGTGGTGGAGGGAGCAGGG + Intergenic
924914528 1:248551543-248551565 ATGCTGTGGTGGAGGGAGCAGGG - Intergenic
1063780757 10:9320614-9320636 CTGTTGGAATGCAGTGAACAAGG - Intergenic
1063957720 10:11282012-11282034 CTGTTGTGGTGGGGCGAGCAAGG + Intronic
1064137537 10:12763940-12763962 CTGTGGGGGTGGGGGCCACAGGG - Intronic
1064906418 10:20350982-20351004 CTGCTGGGGTGAAGAAAACATGG - Intergenic
1065115173 10:22477301-22477323 CTGGTGGAGGGGAGGGAACTGGG - Intergenic
1065588953 10:27246741-27246763 TTGTTGGGGATGAGGGAACGTGG + Intergenic
1066099032 10:32100740-32100762 CTGTTGGGGGGTGGGGGACAAGG - Intergenic
1067141445 10:43660463-43660485 CTGGTGAGTTGGAAGGAACAAGG - Intergenic
1067893732 10:50157664-50157686 GTTTTGGGGTGGGGGGAAGAGGG + Intergenic
1067945748 10:50687011-50687033 GTGTTGGCCAGGAGGGAACAAGG - Intergenic
1069371859 10:67756155-67756177 CAGGTAGGGTGGGGGGAACAGGG + Intergenic
1070341914 10:75505731-75505753 GAGTAGGGGTGGAGGGATCAGGG - Intronic
1070961431 10:80502657-80502679 CGGTTGGGGTTGGGGGACCAAGG + Intronic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071778872 10:88820118-88820140 CTGTTGTGGTGAAGGGTACATGG - Intronic
1072396968 10:95053759-95053781 CTGTTGGGGGGTGGGGAGCAAGG + Intronic
1072623513 10:97096394-97096416 CAGGAGGGGTTGAGGGAACAGGG - Intronic
1072783490 10:98265856-98265878 CAGTGTGGGTGGAGGGAAAAGGG - Intronic
1073094255 10:100970130-100970152 ATCTTGGGGTGGAGGGAACTGGG - Intronic
1075239344 10:120764045-120764067 CTTTTGGAGTGGGGGAAACAGGG + Intergenic
1076371010 10:129953685-129953707 CTGTAGGGGTGGTGGGAGCAGGG - Intronic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076768877 10:132652054-132652076 CTGGTAGGGAGGAGGGACCAAGG - Intronic
1077463544 11:2722794-2722816 CTGGTGGGGTAGAGGGAAGGAGG - Intronic
1077481311 11:2815927-2815949 CTGTCAGGGTGGAGGGGACTTGG + Intronic
1078330932 11:10420344-10420366 CTGTTGGGGTGGGGGGATGGGGG - Intronic
1078442363 11:11378421-11378443 CTGCAGGGCTGGAGGGCACAGGG - Intronic
1078522826 11:12077037-12077059 CTTTTGAGGAGGAGGGAACTGGG + Intergenic
1078653710 11:13219074-13219096 CTGTTGGGGGGTGGGGGACAAGG + Intergenic
1078918401 11:15802869-15802891 CTGTTGGGGGGTGGGGGACAGGG - Intergenic
1079415271 11:20229151-20229173 CTGTTGGGGATTGGGGAACAAGG - Intergenic
1079878600 11:25893771-25893793 ATTTTGAGGTGGAGGGAAGAAGG + Intergenic
1081447776 11:43146974-43146996 CTGTTGGGGGGTAGGGAGCTAGG - Intergenic
1081946749 11:47002616-47002638 GGGGTGGGGTGGGGGGAACAAGG - Intronic
1082245209 11:49913426-49913448 GTTTTGGGGTGGGGGGAGCAGGG + Intergenic
1082673177 11:56059718-56059740 CTGTTGGGGTGTAGGGGGCTAGG + Intergenic
1082791269 11:57348084-57348106 CTGATGGGGGGAAGGGAAGAGGG + Intronic
1082847905 11:57741326-57741348 CGCTTCGGGTGGAGGGGACAGGG - Intronic
1083767730 11:64849909-64849931 CGGGTGGGGTGCAGGGAGCAGGG - Intergenic
1083878478 11:65537008-65537030 TTGTAGGGGTGGCAGGAACAGGG - Exonic
1083944008 11:65913857-65913879 CTGTTGGGGTGGGGGCTGCAAGG - Intergenic
1084370742 11:68741159-68741181 CTGGTGGGGAGGAGGGGTCAAGG - Intronic
1084612414 11:70212124-70212146 GTCTTGCTGTGGAGGGAACATGG - Intergenic
1084777443 11:71386935-71386957 CGGCTGGAGTGGAGGGGACAAGG + Intergenic
1085445138 11:76596469-76596491 CTGTTGGGGTGCAGGGAGGGTGG - Intergenic
1086226196 11:84512981-84513003 CTGTTGGGGTTGGGGGACTAGGG + Intronic
1086739688 11:90352188-90352210 CTGATGGGGATGAGGGGACATGG - Intergenic
1086942669 11:92814703-92814725 CTGTTGGAGTGTAGGGGACAAGG + Intronic
1087192853 11:95273991-95274013 GTCGTGGGGTGGAGGGAGCAGGG + Intergenic
1087428331 11:98018343-98018365 CTGTTGGGGAGTAGGGCACAAGG + Intergenic
1087484658 11:98746536-98746558 CTGTTGGGGGGTGGGGGACAAGG + Intergenic
1087678537 11:101191055-101191077 CTGTTGTGGTGGGGGGAAGGGGG - Intergenic
1087901993 11:103651349-103651371 CTGTTGGGGTGGGGGCACAATGG + Intergenic
1088426675 11:109712471-109712493 CTGTTGGGGAGTAGGGGACAGGG + Intergenic
1088695171 11:112360274-112360296 ATGATGGGATGGAGAGAACATGG + Intergenic
1089125242 11:116172176-116172198 ATGTTTGGGTGGAGGGGAGAGGG - Intergenic
1089685061 11:120141521-120141543 ATGTTGGGGTGGTGGGACGAGGG - Intronic
1089952854 11:122546367-122546389 CTGTTCTGGTGGAGGTGACAAGG + Intergenic
1090039903 11:123281611-123281633 CTGTCGGGGGGTAGGGGACAAGG + Intergenic
1090764253 11:129863266-129863288 CAGTGGGGGTGCAAGGAACAGGG - Intergenic
1090856367 11:130612382-130612404 CTCTTGGGGTGGAGGGATGAGGG - Intergenic
1091062494 11:132476686-132476708 GTTTTGGGGTGGAGGGAGCAGGG + Intronic
1091337034 11:134779708-134779730 CTGTGGGGGTGAAGAGAAAAGGG + Intergenic
1091356396 11:134941036-134941058 CTGTGGGGGGGGGGGGACCAGGG + Intergenic
1092174542 12:6394194-6394216 CTGTTGGGGAGGAGAGAAGCCGG - Intergenic
1092527159 12:9316208-9316230 CTACTGGGGAGGAGGGAGCAGGG + Intergenic
1092540113 12:9415565-9415587 CTACTGGGGAGGAGGGAGCAGGG - Intergenic
1092967400 12:13657662-13657684 GTGTTGGGGGGCAGGGAAGAGGG + Intronic
1094111574 12:26868322-26868344 CTGTTGGGGTGTAGGGGACTAGG + Intergenic
1094210442 12:27884820-27884842 CTCTGGGGATGGAGGGCACAAGG + Intergenic
1094512927 12:31106891-31106913 CTACTGGGGAGGAGGGAGCAGGG + Intergenic
1094523426 12:31216315-31216337 CTGATGTGCTGGAGGGACCAAGG - Intergenic
1094755982 12:33468710-33468732 CTGTTGGGGTGTAGGGGGCTGGG + Intergenic
1096115364 12:49051922-49051944 CTCTTCAGGTGGAGGGGACATGG + Exonic
1096230287 12:49893030-49893052 GTAGTGGGGTGGAGGGAAGAGGG - Intronic
1096773875 12:53952507-53952529 CTGCTGGGGTGGAGGGAATGGGG + Intergenic
1096873316 12:54608451-54608473 TTGCTGGGGTGGAGGGGAGAGGG - Intergenic
1096883654 12:54694894-54694916 CTGTTGGGGGGTAGGGGACAAGG + Intergenic
1097620108 12:61929002-61929024 CTGTTGGGGGGTGAGGAACAAGG + Intronic
1099418815 12:82426875-82426897 GTGTTGTGGTAGAGGGAAGATGG - Intronic
1099790550 12:87329196-87329218 CTGTTGGGATGGAGGGAGAGGGG + Intergenic
1100980146 12:100157124-100157146 CTGTAGGGGTGGAGGGTGGAGGG - Intergenic
1101911310 12:108862062-108862084 CTGATGGGGTGGAGTGGACAAGG + Intronic
1102047673 12:109840007-109840029 ATGATGGGGAGGAGGGAAGAGGG - Intergenic
1102688665 12:114743642-114743664 CTGCTGGGGTGCTGGGCACAAGG + Intergenic
1102929012 12:116848556-116848578 TTGTTGGGGTGGATGGGAGAGGG - Intronic
1102973332 12:117188983-117189005 GAGTGGGGGTGGAGGGAGCAGGG - Intronic
1103047286 12:117747427-117747449 CTGTTGGGGGGTGGGGGACAGGG + Intronic
1103149981 12:118628972-118628994 TTGAGGGGATGGAGGGAACATGG + Intergenic
1104070872 12:125344407-125344429 CTTTTGGGCTAGAGGGAAAAGGG + Intronic
1104953887 12:132454500-132454522 GTGTGGGGGTTGAGGGAACGGGG + Intergenic
1105225108 13:18424758-18424780 CTTTAGGTGTGGAGGGAAAAGGG - Intergenic
1105262841 13:18792484-18792506 TGGTTGGGGTGGAAGGAAAAGGG - Intergenic
1105415151 13:20205547-20205569 CTGTTCATGGGGAGGGAACAGGG - Intergenic
1105699279 13:22923861-22923883 CTGTCGGGGTGGAGGGGAAGGGG + Intergenic
1106286657 13:28323855-28323877 CTTTGGGGAAGGAGGGAACATGG + Intronic
1107106993 13:36654667-36654689 CTGTTGGGGTGTGGGGGACTTGG - Intergenic
1107114043 13:36727211-36727233 CTGTTATTGTGGAGGGAACAGGG - Intergenic
1107269066 13:38593234-38593256 CTGTTGGGGGGTGGGGGACAAGG - Intergenic
1107557411 13:41528808-41528830 TTGTTGGGGTGGAGGGGGTATGG - Intergenic
1107662994 13:42658613-42658635 CTCATGGGCTGGAGGGGACAAGG - Intergenic
1107686327 13:42903406-42903428 CTGTTGGAGTGGAGGATGCAGGG + Intronic
1107829864 13:44364909-44364931 CTGTTGCGGGAGAGGGACCATGG + Intergenic
1108171673 13:47748338-47748360 CTGTTGGGGCTGGGAGAACAAGG - Intergenic
1108332945 13:49408822-49408844 TTTTTGGGGGGGAGGGGACAGGG - Intronic
1108804268 13:54134459-54134481 GTCATGGGGTGGAGGGATCAGGG + Intergenic
1109091495 13:58052104-58052126 CAGTTGGGATGCAGGGAGCAGGG - Intergenic
1109329238 13:60906884-60906906 CTGTTGGGGGGTAGGGGGCAAGG + Intergenic
1109611521 13:64771473-64771495 CTGTTGGGGTGTGGGGGGCAAGG - Intergenic
1109679694 13:65733969-65733991 CTGTTGTGGGGTAGGGGACAAGG + Intergenic
1109904875 13:68827587-68827609 CTGTTGAGGGGTAGGGGACAAGG - Intergenic
1109993350 13:70087911-70087933 CTGTTGGGGTTGGGGGCATAGGG + Intronic
1110258428 13:73457980-73458002 CTGTTGGGGAGTAGGGGGCAAGG - Intergenic
1110331264 13:74276125-74276147 CTGTTGGGGAGTAGGGAGCAAGG - Intergenic
1110394968 13:75019173-75019195 CTGTTGCGGGGTAGGGGACAAGG + Intergenic
1110441553 13:75532115-75532137 CTTTTGGGGTGGAGAGAAGTGGG + Intronic
1111149584 13:84232509-84232531 ATGTGGGAATGGAGGGAACAGGG + Intergenic
1111266032 13:85814709-85814731 CTGTTGGGGTGGGAGGAAAGAGG - Intergenic
1111806514 13:93044989-93045011 GTGTTGGGGTGGAGAGATGAGGG - Intergenic
1112185668 13:97125661-97125683 CCGTTGTGGTGGAGGGAATTAGG + Intergenic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1116752957 14:48909910-48909932 CTGTTGGGGGGTGGGGAGCAAGG + Intergenic
1116885175 14:50213662-50213684 TTTTTGGGGTGGGGGGGACAGGG - Intronic
1116919742 14:50560441-50560463 CTGTTTGGGCGGAGGAACCATGG + Intronic
1117160155 14:52981587-52981609 ATGTGGGGGTGGAGGGTATATGG - Intergenic
1118975745 14:70675042-70675064 GTGTTAGGGTGCAGGAAACAGGG - Exonic
1121684861 14:95828161-95828183 ATGCTGGGGTGGAGGAAAGAAGG + Intergenic
1122603186 14:102931118-102931140 CTGGTGGGGCGGACGGAAAAGGG + Exonic
1123696846 15:22884750-22884772 CTGTGGGGGTGGAGCCATCATGG - Intronic
1124505084 15:30265366-30265388 CTGCTCTGGTGGAGGCAACAGGG - Intergenic
1124738468 15:32273269-32273291 CTGCTCTGGTGGAGGCAACAGGG + Intergenic
1125715649 15:41818449-41818471 CTGTTGGGATGGAGAGGACTTGG + Intronic
1126127899 15:45312878-45312900 CTGTTGGGGTGTGGGGAGCAAGG + Intergenic
1127371874 15:58349056-58349078 TTGTTTTGATGGAGGGAACAAGG + Intronic
1127417650 15:58772266-58772288 CTTTTGGGGTGGAGGAAAACGGG + Intronic
1129393936 15:75234249-75234271 GTGTTGGGGTGGGAGGCACAGGG - Intergenic
1129444492 15:75607358-75607380 AGGTTGTGGTGGAGGGAACCTGG - Intronic
1129691981 15:77718949-77718971 GGGCTGGGGTGGAGGGAACTGGG + Intronic
1129833541 15:78686448-78686470 CTGTTGGGGTTTAGTGACCAGGG - Intronic
1130389744 15:83445256-83445278 CAGGAGGGGTGTAGGGAACAAGG - Intergenic
1130774680 15:86966470-86966492 GTGGTGGGGTGGTGGGAGCAGGG - Intronic
1130966409 15:88700916-88700938 CTCTTGGGGTGGGGGGCGCAGGG - Intergenic
1131350120 15:91692160-91692182 AGGTTGGGGTGGAGGGTCCATGG + Intergenic
1131399111 15:92110466-92110488 AGGTGGGCGTGGAGGGAACAGGG - Intronic
1132086137 15:98909715-98909737 ATGTTGGGGTGGGAGAAACAAGG - Intronic
1132253732 15:100355557-100355579 CTGCTCCGGTGGAGGGAGCAGGG - Intergenic
1132394110 15:101459658-101459680 TTGCTGGGATGGAGGGGACAGGG - Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133012837 16:2924508-2924530 CTGCTGGGCTGCAGGGTACAAGG + Intronic
1133304279 16:4800091-4800113 CAGTCGGGGTGGAGGGGGCAGGG + Intronic
1133844698 16:9443173-9443195 GTGTTGAGGTGCAGGGACCAAGG - Intergenic
1134187127 16:12093267-12093289 GTGTTGGGATGGAAAGAACATGG + Intronic
1134529363 16:14970942-14970964 TGGTTTGGGTGGAGGGAACAAGG + Intergenic
1134792644 16:17003989-17004011 CTATTGGGGTGTGGGGAACTGGG - Intergenic
1135830785 16:25771136-25771158 CTGTTGGGGTGTGGGGGGCAAGG - Intronic
1137967080 16:52946274-52946296 CTGTTGGGGGCTGGGGAACAAGG - Intergenic
1139758645 16:69166254-69166276 AGGTGGGGGTGGAAGGAACATGG + Intronic
1141223392 16:82092264-82092286 CTCTTGGGGTGGAGGGGAGGTGG - Intronic
1142878712 17:2868129-2868151 CTGCTGGGGTGGAGGGCAGCTGG - Intronic
1143328160 17:6114838-6114860 CTGTTGGGGGGTGGGGGACAAGG - Intronic
1143585546 17:7848633-7848655 CTGAGAGGGTGGAGGGAACTTGG - Exonic
1144034246 17:11351135-11351157 CTGTTGGGGGGTGGGGAACAAGG + Intronic
1144145053 17:12389294-12389316 CTGTGAGGGAGCAGGGAACAGGG + Intergenic
1144150908 17:12444673-12444695 CTGTTGGGGGGTAGGGGGCAAGG + Intergenic
1144824580 17:18098601-18098623 GTGTTGGGGAGGAGAGCACAGGG - Intronic
1145838909 17:27977431-27977453 CAGTTGGGGTAGTGGGGACAGGG + Intergenic
1146918586 17:36694636-36694658 CAGTCTGGGAGGAGGGAACAGGG - Intergenic
1147190180 17:38733862-38733884 TCTTTGGGGTGGAGGGAAGAAGG - Exonic
1148206579 17:45783834-45783856 CTATTGGGGGCTAGGGAACAGGG - Intergenic
1148337843 17:46853056-46853078 CTGTTGGGGTGGATCGCAAAAGG - Intronic
1150128526 17:62653734-62653756 CTGTTGGGGAGGAGGGAGGAGGG + Intronic
1150225363 17:63521908-63521930 GGGCTGGGGTGGGGGGAACAAGG - Intergenic
1150563743 17:66319119-66319141 GGGTGGGGGTGGAGGGGACAGGG - Intronic
1150628580 17:66859672-66859694 CTTTTGGGGTGAAGGGAGGAAGG - Intronic
1150893708 17:69184484-69184506 CTGTTCTGGTGGAGGTAGCAGGG - Intronic
1151223145 17:72628377-72628399 CAGTGGGGGTGGTGGGAGCAGGG + Intergenic
1151426854 17:74036424-74036446 CTCTTGGGGAGGAGAGAACAGGG - Intergenic
1151728853 17:75899344-75899366 CTGTTGGGGTGGCGGGGTGAGGG - Intronic
1152003469 17:77662110-77662132 CTGAAGGAGTGGAGGGGACAAGG - Intergenic
1152029641 17:77834136-77834158 CTGCTGGGGTGGTGGGGGCAGGG - Intergenic
1153071860 18:1115583-1115605 CTGCTGTGGTGGAGGTAGCAGGG + Intergenic
1154013470 18:10595484-10595506 CTGGTGGGGTGGAGAGGCCAGGG - Intergenic
1154152695 18:11919079-11919101 CTGGTGGGGTGGAGAGGCCAGGG - Intergenic
1155367789 18:25066153-25066175 CTGTTGGGCTGGAGCAAAAAAGG - Intronic
1155558851 18:27052916-27052938 CTGTTGGGGGTGAGGGGAAAGGG + Intronic
1155861711 18:30909584-30909606 CTGTTGTGGGGGAGGGGAGAGGG + Intergenic
1156165015 18:34408065-34408087 CTGTTGGGGGGTAGGGGACTAGG - Intergenic
1157163476 18:45336582-45336604 CTGTTGGCGATGAGGTAACAGGG - Intronic
1157616471 18:48990492-48990514 CTGTGGGGCTGGATGGAGCAGGG - Intergenic
1158086595 18:53658462-53658484 CTGTTGGGGGGTGGGGGACAAGG - Intergenic
1158419866 18:57283648-57283670 CTGTTGGGGGGTGGGGGACAAGG - Intergenic
1158682954 18:59585117-59585139 CTTTTTGGCTGGAAGGAACATGG - Intronic
1159022556 18:63155498-63155520 CTGCTGGGGTGGAGGCCACAGGG + Intronic
1160929146 19:1561491-1561513 CTGGTGGGGAGGAGGGAAGCTGG + Intronic
1161403429 19:4078812-4078834 CTGTGGGGGTGCTGGGGACAGGG - Intergenic
1161628866 19:5341263-5341285 ATGGTGGGGGGGAGGGGACAGGG - Intergenic
1162068234 19:8138363-8138385 CTGTGGGTGAGGAGGGGACAGGG - Intronic
1162464099 19:10830389-10830411 CAGTTGGGGTGGAGGGCAGGGGG - Intronic
1162976224 19:14208155-14208177 ATCCTGGAGTGGAGGGAACAGGG + Intergenic
1163191582 19:15680552-15680574 GTCTTGGGGTGGAGGGACCATGG + Intronic
1163201633 19:15774008-15774030 GTCTTGGGGTGGAGGGACCATGG - Intergenic
1163508329 19:17720913-17720935 CTGGTGGGAAGGAGGGATCAAGG - Intronic
1163620666 19:18357889-18357911 GGGTTGGGGTGGAGGCAGCAGGG - Intronic
1164450284 19:28356239-28356261 AGGTTGGGGTGGAGGGGAAATGG + Intergenic
1165431616 19:35776227-35776249 CTGTTGGGGTGGAGTAAGGAAGG - Intronic
1166118105 19:40667843-40667865 GTGTGGGGGTGGCAGGAACACGG + Exonic
1166297515 19:41896355-41896377 CCTGTGGGGTGGAGGGAGCAGGG - Exonic
1166738277 19:45098822-45098844 CTGCTGGGGAGTAGGGAACAGGG + Intronic
1166741239 19:45116152-45116174 CTCTTGGGACGGAAGGAACAAGG - Intronic
1166750277 19:45161216-45161238 CTGCTGGTGTGGGGGGGACAGGG + Intronic
1166948260 19:46410444-46410466 CTGCTGGTTTGGAGGGGACAGGG - Exonic
1167005644 19:46774983-46775005 CTGTTATTGTGGAGGGAATAGGG + Exonic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1167311560 19:48740332-48740354 GGGATGGGGTGGAGGGAACCTGG + Intronic
1167411031 19:49343851-49343873 TTTTTGGGGGGGGGGGAACAGGG + Intronic
1167473017 19:49685865-49685887 GTGTTGGAGAGGAGGGAGCAAGG + Intronic
1168165189 19:54542406-54542428 CTGTTCGGGTGTAGGGATCTTGG + Intronic
1168481023 19:56719693-56719715 CTGCTGGGATGGAGGAAAGATGG + Intergenic
925511975 2:4638054-4638076 CTGTTGGGGGGTGGGGGACAAGG + Intergenic
925800345 2:7592636-7592658 CAGTTGAGGTGGACGGGACAGGG - Intergenic
926765708 2:16321293-16321315 CTGTTGCAGTGGCAGGAACATGG + Intergenic
927758359 2:25727102-25727124 CTGTTGGGGTCGGGGGCAGAGGG - Intergenic
927846553 2:26475288-26475310 CAGGTGGAGTGCAGGGAACAAGG + Intronic
927849745 2:26491360-26491382 GTGGAGGGGTGGAGGGAAAAAGG + Intronic
928181193 2:29070265-29070287 CTGTTGGAGGGTAGGGAACAAGG - Intronic
928923052 2:36545992-36546014 CTGGAGGGGTGGTGGGAGCAGGG - Intronic
929331024 2:40681271-40681293 CTGTTGGGGTGTGGGGACCTAGG - Intergenic
929775689 2:44929412-44929434 GTGTTGGGGTGGAGGGCGCGGGG + Intergenic
930574247 2:53126960-53126982 CTGTTCTGGTGGAGGTAGCAGGG + Intergenic
930942756 2:57033271-57033293 CTGTTGGGGGGTGGGGGACATGG - Intergenic
931152662 2:59592241-59592263 GTGTTGGGGTGGGGTGGACATGG - Intergenic
931603369 2:64026794-64026816 CTGGTGGGGTCGGGGGAAGAAGG - Intergenic
931803880 2:65785873-65785895 CTGAAAGGGTGGAGGGAGCAAGG + Intergenic
932784881 2:74591513-74591535 CTGTGGTGGGGGAGGGAGCAGGG + Intronic
934492490 2:94771118-94771140 GGGTTGGGGTGGAAGGAAAAGGG - Intergenic
934695907 2:96400012-96400034 CTGTTGCTGAGGAGGGAAGAGGG - Intergenic
934857671 2:97739231-97739253 CTGTTGGGGTGGCGGGACATTGG - Intronic
934940639 2:98499314-98499336 CTGTTTGAGGGGAGGAAACAGGG - Intronic
937341549 2:121094449-121094471 GGGTTGGGGTGGGGGGCACAAGG + Intergenic
937586069 2:123552336-123552358 CTGTTGGGGTGTTGGGGGCAAGG - Intergenic
938598205 2:132811154-132811176 CTGTTCTGGTGGAGGCGACAGGG + Intronic
939180923 2:138801926-138801948 CTGTTGGGGTGTCGGGTGCAAGG + Intergenic
940432693 2:153611853-153611875 CTGTTGGGGGGTGGGGGACAAGG - Intergenic
940564617 2:155345661-155345683 CTGTTGGGGTGTGTGGAGCAAGG - Intergenic
940640696 2:156342181-156342203 TTTTTGGGGTGGAGGGAACGCGG + Intronic
940855067 2:158723309-158723331 CTGTGGGGGTGGAGGACAAATGG - Intergenic
941478606 2:165977816-165977838 CTGTTGGGGGGTTGGGGACAAGG + Intergenic
941640658 2:167984278-167984300 CTGTTGGAGGGGCAGGAACAAGG + Intronic
942897583 2:181076118-181076140 CTGTTGGCCTGGAGGAAACATGG - Intronic
944109289 2:196114694-196114716 CTGTCGGGGGGTAGGGAGCAAGG - Intergenic
944324946 2:198393164-198393186 CTATTGGGATGGAGGGCACATGG + Intronic
945623162 2:212167933-212167955 CTGTTGGGGTGTGGGGAATGAGG + Intronic
946491857 2:220156341-220156363 TTGTTGGGTTGGAGGAAAAAAGG - Intergenic
947197294 2:227581551-227581573 GTGTTGGGGAAGAGGGACCATGG + Intergenic
947291055 2:228574117-228574139 GTGTTGGGGTGGGGGGAGCGGGG + Intergenic
948016992 2:234699194-234699216 CTTTTGGGGTTGGGGGAAGAAGG + Intergenic
948429147 2:237908306-237908328 ATGCTGGGGTGAAGGGCACAGGG - Intronic
948528366 2:238587424-238587446 CTGTGGGGGAGGGGGGACCAAGG + Intergenic
948964601 2:241367954-241367976 ATGTGGGGGTGGAGGGTATATGG - Intronic
949038743 2:241834641-241834663 CTGAAGGGCTGGAGGGACCAGGG - Intergenic
1168770077 20:408891-408913 CTGATGGGGAGGAGGGTAGAGGG - Intronic
1169068643 20:2708317-2708339 CTGCTGGGGTTGCGGGAACAGGG + Intronic
1169689999 20:8319842-8319864 CTCTTGGGGTGGGGGGAAGGGGG + Intronic
1170050948 20:12144814-12144836 CTGGTGGGCTGGAGGGGCCAAGG + Intergenic
1170741097 20:19057198-19057220 CTGCTGTGGTGGAGGTAGCAGGG - Intergenic
1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG + Intergenic
1171517250 20:25747398-25747420 TTGTTGGGGTGGGAGGAGCAGGG - Intergenic
1171883298 20:30633329-30633351 GGGTTGGGGTGGAAGGAAAAGGG - Intergenic
1172044565 20:32071267-32071289 CTGGTGGGGTGGAGGGGCCAAGG + Intronic
1173075577 20:39815868-39815890 GAGTTGGTGTGGAGGGAAGAAGG - Intergenic
1173183303 20:40820708-40820730 CTGTCGGGGTGGAGGGGACAGGG - Intergenic
1173205641 20:40991150-40991172 CTTTTGGGTTGGAGGGAGCTGGG - Intergenic
1174297368 20:49558380-49558402 CTTTTTTGGTGGTGGGAACAGGG - Intronic
1174421986 20:50405285-50405307 CTGTAGGGGTGGCGGGAGAAGGG - Intergenic
1174509737 20:51042065-51042087 CTGATGGACTGGATGGAACAGGG - Intergenic
1175499063 20:59436660-59436682 CTGTTAGGTTGGGGGGAACTGGG + Intergenic
1175773982 20:61641578-61641600 CTGTAGGTGTGGTGGGATCAGGG - Intronic
1175934568 20:62509107-62509129 GTGTTGGGGTGGAGGGTTGAGGG - Intergenic
1175953872 20:62598068-62598090 CTGCTGGGGGGGATGGAAGATGG + Intergenic
1176711270 21:10151990-10152012 CTGTTGGGGCCCAAGGAACATGG - Intergenic
1176846164 21:13878201-13878223 AGGTTGGGGTGGAAGGAAAAGGG - Intergenic
1177518173 21:22181707-22181729 CTGTTGGTGAGAAGGCAACATGG - Intergenic
1178271994 21:31199385-31199407 ATGGTGGGGGGGAGGGAAAAAGG - Intronic
1178711507 21:34921292-34921314 CTGTGGGGGAGGGGGAAACAGGG - Intronic
1180210954 21:46295377-46295399 GGGTTTGGGTGGAGGGAAGAGGG - Intronic
1181115817 22:20632062-20632084 TGGTTGGGGTGGTGGGGACAAGG + Intergenic
1181426864 22:22849288-22849310 CTGTCTGGCTGGAGGGACCAGGG + Intronic
1181709940 22:24677752-24677774 CTGTTGTGGGGTGGGGAACAAGG - Intergenic
1181862265 22:25828328-25828350 CTGTAGGGGTGGACACAACAGGG - Intronic
1182309093 22:29392023-29392045 CCTTTGGGTTGGAGGGACCAGGG + Intronic
1183197445 22:36363192-36363214 CTGTTGGGGAGGAGGGAGAAGGG - Intronic
1184492016 22:44815242-44815264 GTGTGGGGGAGGAGGGAGCATGG + Intronic
949608587 3:5680627-5680649 CTGTTGGGGGGTGGGGGACAAGG + Intergenic
949676677 3:6462668-6462690 CTGTGTGTGTGTAGGGAACATGG - Intergenic
950558552 3:13709199-13709221 TTATTGGGGTGGAGGGCACCTGG + Intergenic
950902070 3:16506660-16506682 CTGCTTGGGTGGAGTTAACATGG - Intronic
951512702 3:23521882-23521904 CTGGGGGGGTGGGGGGTACACGG - Intronic
953075358 3:39564941-39564963 CTATTTGGGTGAAGGGAGCATGG + Intergenic
953108265 3:39907152-39907174 CAGATGGAGAGGAGGGAACATGG - Intronic
954700362 3:52447702-52447724 CCGTGGGGGTGGAGGGGGCATGG - Intergenic
955113371 3:55972424-55972446 CTGTTGGGGTGTTGGGGACAAGG - Intronic
955234699 3:57129603-57129625 CTGTTGGGGTGGAGGAGGCTGGG - Intronic
955538669 3:59951608-59951630 ATGGTGGGGTGGGGGGCACAAGG - Intronic
956006408 3:64783121-64783143 CTATTGGGGTGTGGGGGACAAGG + Intergenic
956821449 3:72957862-72957884 TTGGTGGGGTAGAGGGAAAAAGG + Intronic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957276559 3:78097552-78097574 CTGTTGGGGGGTAGGGGGCAAGG - Intergenic
958609783 3:96410395-96410417 CTGCTGGGGTGGAGCCCACATGG - Intergenic
958615059 3:96482737-96482759 CTGTTGGGGGGTGGGGAAAAGGG - Intergenic
959808033 3:110581595-110581617 CTGGAGGAGTGGAGGGGACAGGG - Intergenic
959900622 3:111657500-111657522 GGGTGGGGGTGGTGGGAACAAGG + Intronic
959919823 3:111858297-111858319 CTGTTGGGGGGTGGGGGACAAGG + Intronic
961232862 3:125334847-125334869 CTGCTGGAGTGGAGTGAACAAGG - Intronic
961393159 3:126568653-126568675 CTGCTGGGGAGGAGGGGTCAGGG + Intergenic
961676227 3:128568616-128568638 TTGTTGGGGTGGAGTGAGGATGG - Intergenic
962211486 3:133482846-133482868 CTGTTGGGGTGGGGGGCGCTGGG + Intergenic
962435851 3:135366072-135366094 CTGTTGGGCTGGACGGAACTGGG - Intergenic
962874358 3:139524534-139524556 CTGTGGGGGTGGGGTGAACATGG + Intronic
962901957 3:139769208-139769230 CTGTTGGGGGAGAGGGGGCAAGG + Intergenic
963280876 3:143383827-143383849 CTGTTGGGGTGGGGGAAGCAAGG + Intronic
963358072 3:144235694-144235716 CTGTAGGTGTGCAGGGGACAGGG - Intergenic
964147996 3:153489354-153489376 TTGTAGAGGTGGAGGGAAGAAGG - Intronic
964325034 3:155535933-155535955 CTGTTCTGGTGGAGGTAGCAGGG - Intronic
964411027 3:156398228-156398250 CTGTCGGGGTGGTGGGAAAAGGG + Intronic
967016805 3:185489676-185489698 CTGTCGGGGTGGAGGGAGGGAGG + Exonic
967180425 3:186898397-186898419 CTGCTGGGGTGTAAGGAAGATGG - Intergenic
968819329 4:2837773-2837795 CAGTCTAGGTGGAGGGAACAGGG - Exonic
969746962 4:9080148-9080170 CTCTGGGGCTGGAGGGAGCAGGG - Intergenic
972149544 4:36071845-36071867 GTGTTGGGGTGGGGGGAGCGGGG - Intronic
972281213 4:37603608-37603630 CTTTTGGGGTGGAGGAAGCCTGG + Intronic
972695530 4:41441965-41441987 CTCTTGGGTTAGTGGGAACATGG + Intronic
972815187 4:42637127-42637149 CGGTTGAGGTACAGGGAACAGGG - Intronic
972899721 4:43668624-43668646 CTGTTCTGGTGGAGGTAGCAGGG + Intergenic
973068339 4:45825066-45825088 GTGTTGGGGTGGAGGGAGGGGGG + Intergenic
973822651 4:54676583-54676605 CTGCATGGGTGGAGGGAGCAGGG + Intronic
973920156 4:55675927-55675949 CTGCTCTGGTGGAGGTAACAGGG - Intergenic
975503759 4:75116273-75116295 CTGTTGGGGTGTGGGGGACTGGG + Intergenic
976278498 4:83303019-83303041 TTATTGGGGTGGGGGGAATAAGG - Intronic
976721607 4:88174318-88174340 CTGTTGGGGAGTAGGGAGCAAGG - Intronic
976936867 4:90646947-90646969 GTGTTGGGGTGGGGGGATGAGGG - Intronic
977037164 4:91969054-91969076 CAGTAGGGGTGGGGGGAAAACGG - Intergenic
977634837 4:99285485-99285507 CTGTTACAGTGGAGGGAGCATGG + Intronic
977637538 4:99317002-99317024 CTGTTATGGTGGAGGGAGTAGGG + Intronic
977687181 4:99860270-99860292 TTGTTTGGGTGGAGGTAAGATGG + Intronic
977723860 4:100271362-100271384 CTCTTGTGGTGGAGGAAAGAGGG + Intergenic
978241398 4:106520983-106521005 CTGCTGTGGTGGAGGGGTCAAGG + Intergenic
978777682 4:112519349-112519371 CTGCGGGGGTGGGGGGAAGAGGG + Intergenic
978990492 4:115076080-115076102 TTGTTGGGAAAGAGGGAACAAGG - Exonic
980317098 4:131216558-131216580 CTGTTGGGGTTGGGGGACAAGGG - Intergenic
980688147 4:136256877-136256899 CTGTTGGGGGTCAGGGGACAAGG + Intergenic
980808953 4:137851095-137851117 CTGTTGGGGGTGAGGGAGCTAGG - Intergenic
982284776 4:153723975-153723997 CTCTTTGGGTGGAGGGGACATGG - Intronic
982316331 4:154035801-154035823 CTGTCGGGGAGGAGGGGAAAGGG + Intergenic
982630610 4:157824705-157824727 CTGTTCTGGTGGAGGTAGCAGGG - Intergenic
982815881 4:159883934-159883956 CTCTTGTGGTGGAGAGAGCAAGG + Intergenic
983526248 4:168763019-168763041 CTGTTGGGGTAGGGGGCAAAGGG + Intronic
983543936 4:168942227-168942249 CTGTTGGGGGGTGGGGAGCAAGG + Intronic
985352187 4:189076110-189076132 CTGTTGGGGTGTAGGGGGCAAGG + Intergenic
985643614 5:1074869-1074891 CTGTGGCTGTGGAGGGAACGAGG + Intronic
985794256 5:1950236-1950258 CTCTCGGTGTGGAGGGAAGAGGG + Intergenic
986076591 5:4344228-4344250 ATGTTGGGGAGTAGGGGACAAGG - Intergenic
987233276 5:15917130-15917152 CTGTTGAGGTGGAAAGAGCATGG - Intronic
987876177 5:23684501-23684523 CTGTTGGGCAACAGGGAACAGGG + Intergenic
988034790 5:25813288-25813310 CTGTGGGGGTGGAGGAAATAGGG - Intergenic
988232757 5:28502198-28502220 GTGGTGGGGTGGGGGGAGCAGGG - Intergenic
988276155 5:29083268-29083290 CTGTTGGTGTGCAGGGGACAAGG + Intergenic
988588620 5:32529785-32529807 CTGTTGGGGGGCAAGGCACAGGG + Intergenic
988867172 5:35348191-35348213 CTGTTGGAGTGTGGGGAACTAGG - Intergenic
988974878 5:36505158-36505180 CAGTGGGGGTAAAGGGAACATGG + Intergenic
990582136 5:57174783-57174805 CTGAGGGGGTGGAAGGTACAGGG - Intronic
990908409 5:60828016-60828038 CTGTTAGGGGAGAGGGAACTAGG - Intronic
991991479 5:72344144-72344166 CTGTGGGGTTGGAGGGAATGAGG + Intronic
992404680 5:76445838-76445860 TTGTTGGGGAGGAGAGAACGGGG - Intronic
994015600 5:94961266-94961288 CTGTTGGGGGGTGGGGGACAAGG + Intronic
994646110 5:102470849-102470871 CTGTTCTGGTGGAGGTAGCAGGG + Intronic
995581410 5:113606685-113606707 CCCTTGGGCTGGAGGGCACATGG + Intergenic
996025341 5:118639046-118639068 CTGTTCTGGTGGAGAGAGCAGGG - Intergenic
997339666 5:133133258-133133280 GTTTTGGGGTGGGGGGAGCAGGG - Intergenic
997405041 5:133639123-133639145 CTGTCGGGGAGTGGGGAACAAGG - Intergenic
997976853 5:138445941-138445963 CTGTGGGGGTTGAGGGTAGAGGG + Exonic
998391254 5:141788406-141788428 CTGTTAGGGTAGAGGGGAGAAGG - Intergenic
998698981 5:144675399-144675421 GAGTTGGGGTGAAGAGAACAGGG - Intergenic
998715817 5:144883579-144883601 CTGTTGGGGAGTGGGGGACAAGG - Intergenic
999029461 5:148275131-148275153 CTGTTGGGGGAGCGGGGACAAGG - Intronic
999041670 5:148420642-148420664 CTAATGGGGTGGAGGGATGAGGG - Intronic
999242574 5:150136364-150136386 CTTTTGGGCTGGAGGGAACTGGG + Intronic
1001050427 5:168409588-168409610 CAGTTGGTGAGGAGGAAACAGGG - Intronic
1001253265 5:170165005-170165027 GTGGTGGGGTGGAGGACACATGG - Intergenic
1001720779 5:173855361-173855383 CTGTTGGCCAGGAGGGAAAAAGG - Intergenic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002261243 5:177995317-177995339 CTGTTGGGGAGGAGAGAACGGGG + Intronic
1003109499 6:3241736-3241758 CTGTTGGGGTGGGGGGCAAGGGG - Intronic
1004194463 6:13490679-13490701 GTGTTGGGGTGGGGGGAATGGGG - Intergenic
1004418597 6:15447579-15447601 GGGTTGGGGTGGAGAGAGCACGG - Intronic
1005034475 6:21543071-21543093 CTGTCGGGGGGTGGGGAACAAGG - Intergenic
1005101130 6:22173504-22173526 CTGTTGGGGTGGAGCCCTCATGG + Intergenic
1006575886 6:35045513-35045535 GTGTAGGGGTGGAAAGAACAAGG - Intronic
1007984214 6:46191132-46191154 CTGTTGGCCTTGAGGGAACAAGG + Intergenic
1009376551 6:62978201-62978223 CTGTCGGGGTGGAGGGCAAGGGG - Intergenic
1010807049 6:80249650-80249672 CTCTTGGGGTGGAGGTAAGAGGG + Intronic
1010898480 6:81396126-81396148 CTGTTGTTTTGGAGGGAATAAGG - Intergenic
1011393542 6:86881082-86881104 CTGTTGGGGTATGGGGAGCAAGG - Intergenic
1012134171 6:95535332-95535354 CTGCTGGGGTGGAGGAGAAAAGG - Intergenic
1012210671 6:96514806-96514828 TTGTCGGGGTGTAGGGAGCAAGG - Intergenic
1012226643 6:96711345-96711367 CTGTTGGGGTGTGGGGTGCAGGG + Intergenic
1012644104 6:101658201-101658223 CTGTTGGGGGTGAGGGACTAGGG - Intronic
1012667969 6:102001353-102001375 CTGTCGGGGGGTGGGGAACAAGG - Intronic
1012701416 6:102461467-102461489 CTGTTGGGGGCTGGGGAACAAGG + Intergenic
1012768633 6:103400559-103400581 CTTATGTGGTGGAGGGGACAAGG + Intergenic
1012855388 6:104495257-104495279 GTGGTGGGGTGGGGGGAGCAGGG + Intergenic
1013576995 6:111493756-111493778 CTGTTGGGGGGTGGGGGACAAGG - Intergenic
1014353152 6:120368840-120368862 CTGTTGGGGAGGAGGGGGTAAGG + Intergenic
1015769633 6:136755298-136755320 TTCTTGGGGTGGCGGAAACAGGG - Intronic
1016154044 6:140781182-140781204 CTGTGGTGGTGGAGGCCACAAGG + Intergenic
1016281295 6:142422309-142422331 GTGGTGGGGTGGGGGGAGCAGGG - Intronic
1016848252 6:148590657-148590679 CTGGTGGGGAGGAGGAAATAAGG + Intergenic
1018067738 6:160135415-160135437 TTATTGTGGTGGAGGGAAGAGGG + Intronic
1018453062 6:163926826-163926848 CTGTTGGCTGGGAGGAAACATGG + Intergenic
1018721266 6:166574310-166574332 CTGCTGGGGAGGAGGGAAGGAGG - Intronic
1018862249 6:167719647-167719669 CTGTTGGGGTGGTGGGCAAGAGG + Intergenic
1019797337 7:3060781-3060803 CTGTTGGAGTGGATGTAAAATGG - Intergenic
1020034050 7:4953135-4953157 CTGTAGGGATGGAGGAAACAGGG - Intronic
1020326489 7:6978417-6978439 CTCTGGGGCTGGAGGGAGCAGGG + Intergenic
1020568299 7:9824697-9824719 CTGTTGGGGGTGAGGGATGAGGG - Intergenic
1020642366 7:10771316-10771338 CTGATGGGGTTGAGGAGACAGGG - Intergenic
1021195401 7:17668628-17668650 CTGTTGGGGAGTAGGGGACTGGG + Intergenic
1021569728 7:22052596-22052618 AGGTTGGGGTGGAGGGAGGAAGG + Intergenic
1022672626 7:32470398-32470420 GTTGTGGGGTGGAGGGAGCAGGG + Intergenic
1022880997 7:34587256-34587278 CTGTTGATCTGAAGGGAACATGG - Intergenic
1024195713 7:47056928-47056950 TAGTTGGGGTGGAGGGAGCAGGG + Intergenic
1024626524 7:51212632-51212654 CTGGTGGGGTGGCATGAACAGGG - Intronic
1025813396 7:64889325-64889347 CTGTTGGGGCGGAGGGGACGCGG - Intronic
1025859239 7:65311098-65311120 CTGTTAGGGGGCAGTGAACATGG - Intergenic
1025926894 7:65967577-65967599 CTGTTGGCGGTGAGGGAACGTGG + Intronic
1026910601 7:74089681-74089703 GTGTTGAGCTGGAGGGGACATGG + Intronic
1027987440 7:85311435-85311457 CTGTTGCAGAGAAGGGAACAAGG + Intergenic
1028782926 7:94757675-94757697 CTGTTCTGGTGGAGGTAGCAGGG - Intergenic
1028855617 7:95589273-95589295 CTGTGGGGGTGGAGGTAACAAGG + Intronic
1029252567 7:99247571-99247593 CTGGTGGGAGGGAGGGAAGATGG - Intergenic
1029707825 7:102285053-102285075 CTGTGGGGGTGGAGGGGGCGTGG - Intergenic
1029879304 7:103790178-103790200 CTGTTGTGGGGGCGGGGACAAGG + Intronic
1029990649 7:104959870-104959892 CTGTTGGGGGGTAGGGGGCAGGG + Intergenic
1030301164 7:107976353-107976375 CTGGTGTGGTGGTGGGAATATGG - Intronic
1031838930 7:126713439-126713461 CTGTTGGCAGGTAGGGAACAAGG + Intronic
1032506358 7:132437602-132437624 CTCTTGGTGCGGAGGGTACAGGG - Intronic
1033342690 7:140504466-140504488 GTGTTGGAGTGGGGGGTACAAGG - Intergenic
1033459029 7:141528734-141528756 CTGTTGGAGAGGAGGGGAGATGG - Intergenic
1033547134 7:142411862-142411884 CTGTTGGGGCGGGGGGGTCAAGG + Intergenic
1034317012 7:150142342-150142364 CTGCTCGGGTGGAGGGAATGAGG + Intergenic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1034691916 7:153020912-153020934 CTGTTGGGGGGTGGGGGACAAGG - Intergenic
1034789853 7:153958342-153958364 CTGCTCGGGTGGAGGGAATGAGG - Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1034958908 7:155352134-155352156 CTGCTGGTGTGCAGGGGACACGG + Intergenic
1035081597 7:156220652-156220674 ATGTTGGGGTGCAGGGCTCACGG + Intergenic
1036051093 8:5197701-5197723 GTGGTGGGGTGGAGGGAGGACGG + Intergenic
1036643103 8:10596191-10596213 CTGTTGGGGAGTTGGGAGCAAGG + Intergenic
1036988193 8:13560764-13560786 CTGTGGGGGGGGAGGGAAAAAGG + Intergenic
1037303419 8:17478421-17478443 TTTTTGGGTTGGAGGGTACAAGG + Intergenic
1037636117 8:20702166-20702188 CTGATGGGGTGCAGGGAATATGG + Intergenic
1037693991 8:21207899-21207921 CTGTGGGGGTGGGGGGTAGAGGG - Intergenic
1037889807 8:22617959-22617981 CTGTTGGGGTGAATGGGAGAGGG + Intronic
1037974833 8:23201679-23201701 CTATGGGGGTGGAGGCACCATGG + Intronic
1038357881 8:26847065-26847087 GTCGTGGGGTGGGGGGAACAGGG + Intronic
1038699180 8:29834231-29834253 CTGTTGAGGGGGTGGGAAGAGGG - Intergenic
1039164496 8:34662439-34662461 GTGTTGGGGTGCAGTGAGCAAGG + Intergenic
1041628688 8:60060500-60060522 CGGGTGGGGTGGGGGGAGCAGGG + Intergenic
1041900082 8:62972822-62972844 CTGTTGGGGAGTGGGGGACAAGG - Intronic
1042862194 8:73326164-73326186 CAGTAGGGGTTGGGGGAACAGGG + Intergenic
1043545177 8:81306985-81307007 CTGTTCTGGTGGAGGTAGCAGGG - Intergenic
1044608350 8:94067622-94067644 GTTGTGGGGTGGGGGGAACAGGG - Intergenic
1044727665 8:95206632-95206654 CTGTTGGGAAGGAGGAAAGAGGG - Intergenic
1045634981 8:104174353-104174375 TTGTTGGGGTGGAGGTTAAATGG + Intronic
1046002218 8:108434551-108434573 CTGGTGGGGTGGGGGGTATAAGG + Intronic
1046047413 8:108980773-108980795 CTGTTGGGGGGTAGGGAACAAGG - Intergenic
1047761507 8:127958050-127958072 GTGGTGAGGTGAAGGGAACACGG + Intergenic
1047937450 8:129796777-129796799 CTGCTCTGGTGGAGGTAACAGGG + Intergenic
1048293380 8:133197196-133197218 CTGTTGGGGTCCATGGAAAAAGG - Intronic
1048826086 8:138428661-138428683 CTTTTGTGGTGGAGGGAGCCTGG - Intronic
1049297764 8:141852270-141852292 CTGTGGGGGTGGTGGGAGCAAGG + Intergenic
1049443942 8:142621586-142621608 CTGGTGGGGAGGATGGAAAAGGG + Intergenic
1049586786 8:143436078-143436100 CTGCTGGGGTGGTCGGAACAGGG - Intergenic
1049833085 8:144714318-144714340 CCGTCGGGGTGGAGGGAGCTGGG + Intergenic
1051091113 9:13409528-13409550 CTGTTGGGGGTTAGGGGACAAGG - Intergenic
1051328061 9:15994431-15994453 GTCATGGGGTGGAGGGAGCAGGG + Intronic
1052024932 9:23563674-23563696 GTGGTGGGGTGGGGGGAGCAAGG - Intergenic
1052535168 9:29737267-29737289 CTGTTGGGGTGCGGGGGGCAAGG - Intergenic
1052591178 9:30497718-30497740 TTGCTGGGCTGGAGGGACCAAGG + Intergenic
1053443086 9:38131632-38131654 CTGTTTGGGAGGAGGGGACGGGG + Intergenic
1053665511 9:40314836-40314858 GGGTTGGGGTGGAAGGAAAAGGG + Intronic
1053728822 9:41031572-41031594 CTGTTGGGGTGGAGGGAACATGG + Intergenic
1053915096 9:42939883-42939905 CGGTTGGGGTGGAAGGAAAAGGG + Intergenic
1054519103 9:66061448-66061470 GGGTTGGGGTGGAAGGAAAAGGG - Intergenic
1054699688 9:68400511-68400533 CTGTTGGGGTGGAGGGAACATGG - Intronic
1055137966 9:72844637-72844659 CTGCTGTGGTGGAGGTAGCAGGG - Intergenic
1056506969 9:87266663-87266685 CTGTTGTGGTGGTGTGAAAACGG + Intergenic
1056927524 9:90847547-90847569 CTGCAGGTGTGGAGGGAGCACGG - Intronic
1057212753 9:93209640-93209662 GTGCTTGGGTGGAAGGAACAAGG + Intronic
1058177605 9:101755585-101755607 CTGTTGGGGTTGAGGGAAGCAGG + Intergenic
1058193059 9:101941537-101941559 CTGAGGGGGTGGAGCCAACATGG - Intergenic
1058591621 9:106571436-106571458 CTGTTGGGGGATGGGGAACAAGG + Intergenic
1058945838 9:109855078-109855100 TTTTTGGGGTGGGGGAAACAGGG + Intronic
1059059895 9:111024697-111024719 CTGTTGGGGGGTGGGGGACAAGG - Intronic
1060320650 9:122556511-122556533 CTGTTGGGGGTTAGGGGACAAGG + Intergenic
1060813923 9:126625150-126625172 CGGAAGGGGTGGAGGGGACACGG - Intronic
1060907261 9:127317860-127317882 ATGTTGGGGTGGAGAGATCCTGG + Intronic
1061419218 9:130464217-130464239 CTGATGGGGAGGAGGGCACAGGG + Intronic
1062343468 9:136103986-136104008 CTGCTGGGGTTCAGGGAACTCGG + Intergenic
1062344089 9:136106908-136106930 CAGTTTTGGTGGAAGGAACAGGG + Intergenic
1185518541 X:719120-719142 CTGTTGGGGGGTGGGGAACTGGG - Intergenic
1187507410 X:19888172-19888194 CTGTTGGAGGGGAAGGAAAAGGG + Intergenic
1188340693 X:28997774-28997796 TTGTGGGGGTGGGGGGAACATGG - Intronic
1188886830 X:35561095-35561117 CTGCTACGCTGGAGGGAACAAGG - Intergenic
1190087701 X:47410115-47410137 CTTTTGGGGTGGGGGGTACCTGG - Intronic
1191083667 X:56540417-56540439 CTGTTGGGGGTGAGGGAAGGTGG + Intergenic
1191703796 X:64071242-64071264 CTGTGGTGGTGGTGGCAACAGGG + Intergenic
1192220025 X:69191601-69191623 CTTTTTGGCAGGAGGGAACATGG - Intergenic
1192635074 X:72808250-72808272 CTGTAGGGGGGGAGGGACGATGG - Intronic
1192646641 X:72912553-72912575 CTGTAGGGGGGGAGGGACGATGG + Intronic
1192680446 X:73248274-73248296 CTGTAGGGGTGGAGTGCTCATGG + Intergenic
1192888056 X:75358036-75358058 CTGGTGGAGCGGAGGGAAAATGG + Intergenic
1192899601 X:75482125-75482147 GTGTTGGGGGGTGGGGAACAAGG + Intronic
1192964736 X:76165325-76165347 CTGTTGGGGGGTAGGGAGCTAGG + Intergenic
1193232030 X:79058395-79058417 GTTGTGGGGTGGGGGGAACAGGG + Intergenic
1193567616 X:83097474-83097496 GTCATGGGGTGGAGGGAGCAGGG + Intergenic
1193596716 X:83455215-83455237 TTCTTGGGGTTGGGGGAACAGGG + Intergenic
1193612421 X:83648868-83648890 CTGTTGTGGGGTAGGGGACAGGG - Intergenic
1194095270 X:89631930-89631952 CTGTTCTGGTGGAGGTAGCAGGG + Intergenic
1195050885 X:101095867-101095889 CTGTTACGGTTGAGGGAACAGGG + Exonic
1195881308 X:109595551-109595573 CTGTTGGGGGGTGGGGGACAAGG - Intergenic
1196794797 X:119493542-119493564 CTGTGGGTGGCGAGGGAACAGGG - Intergenic
1197106751 X:122725890-122725912 CTGCTGTGCTGGAGGGGACAAGG - Intergenic
1197518962 X:127473430-127473452 CTGTTCTGGTGGAGGTGACAGGG - Intergenic
1197712228 X:129679498-129679520 CTGCTGGAGTGGCGGGATCATGG + Intergenic
1198792673 X:140362601-140362623 CTGTTGGTGTGCAGAGAATAGGG - Intergenic
1199078389 X:143549593-143549615 CTGCTGAGATGGAGGGAAAAAGG + Intergenic
1199524371 X:148776006-148776028 CTGTTGGGGTGTGGGGGGCAAGG - Intronic
1200760644 Y:7035792-7035814 CTGTTGGGGTGGGGGGATAGGGG + Intronic
1201686354 Y:16707559-16707581 CTGTTGGGGTTGAGGGGCTATGG + Intergenic
1201759711 Y:17523413-17523435 CTGAAGGGGTGGAGAGCACAAGG + Intergenic
1201841843 Y:18382577-18382599 CTGAAGGGGTGGAGAGCACAAGG - Intergenic
1202041450 Y:20689628-20689650 CTGTTGTGGGGTAGGGGACAGGG - Intergenic