ID: 1054706519

View in Genome Browser
Species Human (GRCh38)
Location 9:68468184-68468206
Sequence CCGGGTCTTCTTGAGGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 83}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054706519 Original CRISPR CCGGGTCTTCTTGAGGAGTA GGG (reversed) Intronic
902088605 1:13883939-13883961 CTGTGTCTTCTTGAGGAGCTGGG - Intergenic
904866342 1:33581989-33582011 CCAGGTCTTCCTGAGAACTATGG - Intronic
906020072 1:42620227-42620249 TGAGGTCTACTTGAGGAGTAGGG + Intronic
909285207 1:73807526-73807548 CCGGGGCTTGTTGTGGGGTAGGG + Intergenic
910356369 1:86361404-86361426 CCGTGTCTCCCTTAGGAGTATGG - Intronic
917724230 1:177813946-177813968 CCTGCTCTTATTGAGGAGTAGGG - Intergenic
1067255017 10:44629062-44629084 CCGGGGGTTGCTGAGGAGTAAGG - Intergenic
1068024352 10:51624316-51624338 CCCTGTTTTCTTGAGGAGTAAGG + Intronic
1073378848 10:103062253-103062275 GGGGGTCGTCTTGTGGAGTATGG + Intronic
1075684555 10:124354383-124354405 CAGGGTCTGCTTTAGGAGTGAGG + Intergenic
1081067810 11:38568391-38568413 AATGTTCTTCTTGAGGAGTAAGG - Intergenic
1089775362 11:120831942-120831964 CCGGATCTCCTTGAGGAGCGGGG - Exonic
1089880086 11:121765352-121765374 CCGGGTTCACTTGAGGAGTGAGG + Intergenic
1090489370 11:127144640-127144662 CTCGGTCTTCTTGAGCACTAGGG + Intergenic
1090898499 11:131003502-131003524 CAGGGTCTCCTTGAGGACAAAGG - Intergenic
1091073420 11:132590951-132590973 CTGGTTCTTCTAGAGGATTATGG - Intronic
1105968433 13:25405451-25405473 CCAGGTCTTCTTTCTGAGTATGG + Intronic
1106483715 13:30155245-30155267 CGGGGTGTCCTTGAGGAGGAGGG - Intergenic
1107388250 13:39936365-39936387 CCGGGGCTTGTTGTGGGGTAGGG + Intergenic
1107836336 13:44414973-44414995 TCGGGTCTTCTTTAAGAGCACGG - Intergenic
1108416813 13:50206011-50206033 CCTGGTCTCCTTGAGGCCTAGGG - Intronic
1109207921 13:59501967-59501989 CTGGATCATCTTGTGGAGTAAGG - Intergenic
1112922895 13:104637111-104637133 CTGGCGTTTCTTGAGGAGTAGGG + Intergenic
1113896575 13:113768448-113768470 CTGGGGCTTCCTGTGGAGTAAGG + Intronic
1117760876 14:59027057-59027079 CCAGGGCCTTTTGAGGAGTAGGG + Intergenic
1118149843 14:63178088-63178110 AGGTGTCTTCTGGAGGAGTAAGG - Intergenic
1118569646 14:67180687-67180709 GCGGGTCTTCAAGAGGAGAAGGG - Intronic
1124202503 15:27690519-27690541 CCGTCTCTTCTGGAGGAGTTAGG - Intergenic
1128940656 15:71785122-71785144 CCTGGTCTGCTGGAGGAGTCCGG - Intergenic
1131102447 15:89703550-89703572 CCAGGCCTCCATGAGGAGTATGG + Intronic
1134812458 16:17179223-17179245 CAGGGTCTCCTTGAGGAGGCAGG + Intronic
1135588611 16:23689941-23689963 CTGAGTCTCCTGGAGGAGTACGG + Exonic
1140520895 16:75580683-75580705 TAGTGTCTTTTTGAGGAGTAGGG - Intergenic
1142181905 16:88675328-88675350 CCGGGTCTTGAGGAGGAGTAGGG - Intergenic
1144428057 17:15163650-15163672 CAGGGTCTACTTGAGGATTGAGG + Intergenic
1149127538 17:53254260-53254282 TAGAGTCTTCTAGAGGAGTATGG - Intergenic
1151479915 17:74363992-74364014 CCGGGTCTTCTTGATGATCCAGG - Intergenic
1152458904 17:80431203-80431225 CCTGGTGTTCCTGAGGAGCAGGG + Intronic
1157732447 18:50015932-50015954 CCTGGTCATCTTGAGCACTATGG + Intronic
1167777190 19:51566028-51566050 CCGTGTCTTCTTGTGTAGGAGGG - Intergenic
928103540 2:28453213-28453235 TCGGGTCTTGTTGGGGAGTTTGG + Intergenic
932929081 2:76012441-76012463 CCGGGGCCTGTTGTGGAGTAGGG - Intergenic
936232551 2:110715934-110715956 CCTGGTCTTCCTGAGAAGTAAGG + Intergenic
936403084 2:112181172-112181194 CTGGGTCTACTTGAGGGGTTGGG + Intronic
936593439 2:113825369-113825391 CCGTGTCTCGTTGAAGAGTAGGG + Intergenic
940435298 2:153646616-153646638 CCGGGGCCTGTTGTGGAGTAGGG - Intergenic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
1170648323 20:18216241-18216263 GAGGCTCTGCTTGAGGAGTAGGG - Intergenic
1170830229 20:19833415-19833437 CCGGGTCCTGTTGGGGAGTCGGG - Intergenic
1171196237 20:23201677-23201699 CAGGGTTTTCTTGAGTAGTTTGG + Intergenic
1177545028 21:22545448-22545470 CCGGGTCTTCTGGAGGTATTAGG + Intergenic
1181500509 22:23313223-23313245 CTTGGTCTCCTTGAGGAGTAGGG - Intronic
1181705730 22:24648534-24648556 CTTGGTCTCCTTGAGGAGTAGGG - Intergenic
949151309 3:771033-771055 CCGGATGTTCTTGAGGATTTGGG - Intergenic
956309201 3:67860417-67860439 CCTGGTCCTTTTGAGAAGTAAGG + Intergenic
957092539 3:75746027-75746049 CCGGGGCTTGTTGTGGGGTAGGG - Intronic
958972163 3:100623704-100623726 CCGGGGCCTGTTGGGGAGTAGGG - Intronic
963612269 3:147485101-147485123 CCGGGTCCTGTTGTGGGGTAGGG - Intronic
973599537 4:52528179-52528201 CCGGGGCCTGTTGAGGAGTGGGG + Intergenic
980263689 4:130487843-130487865 AAGGTTCTTCTTGAGGAGTTGGG + Intergenic
982431885 4:155332354-155332376 CGGGGACTTCTAGAGGAGAATGG - Intergenic
989531981 5:42518334-42518356 CATGGTCTTCTTGAGGTGTAGGG + Intronic
993554310 5:89316571-89316593 CTGGGTCTTGTTGGGGAGTGGGG - Intergenic
998038137 5:138933695-138933717 CCTGGTCTTGCAGAGGAGTAGGG + Intronic
1004288596 6:14346053-14346075 CTGGCACTTCTTGAGCAGTATGG + Intergenic
1005844839 6:29769266-29769288 CTGGGTCCTCTTGTGGAGCATGG - Intergenic
1007126682 6:39431665-39431687 TCGGCTCTTCTTCAGGAGTTAGG + Intronic
1008604616 6:53128352-53128374 AGGGGTCTTCTTGAGGTGAATGG + Exonic
1008708483 6:54193930-54193952 CCTGGTCTTCTTTGGCAGTAGGG + Intronic
1010607319 6:77907291-77907313 CCGGGTCCTGTTGTGGAGTGCGG - Intronic
1012339301 6:98099686-98099708 CTGGGTCTTCCTGAGGGGGAAGG - Intergenic
1015769240 6:136752339-136752361 CCAGCTCTTCCTGAGGAGGAAGG + Intronic
1016523359 6:144971860-144971882 CCGGGGCCTGTTGAGGAGTGGGG - Intergenic
1017306467 6:152923744-152923766 CCGGGGCCTGTTGTGGAGTAGGG - Intergenic
1023165279 7:37337363-37337385 CCGGGGCCTCTTGTGGGGTAAGG + Intronic
1028840886 7:95429187-95429209 CCGGGGCCTCTTGTGGGGTAGGG - Intronic
1031075472 7:117208330-117208352 CCAGGTCTTTCTGTGGAGTATGG + Intronic
1032772417 7:135072751-135072773 CCGGGGCTTGTTGTGGAGTGGGG + Intronic
1034226977 7:149491782-149491804 GCGGGTCTTCTGGAGGAATCAGG + Intronic
1037552854 8:19992038-19992060 CTGGGTCTGATTGAGGAGCAGGG - Intergenic
1044431611 8:92114131-92114153 CCGTGACTTCTGGAGAAGTAGGG - Intergenic
1045113267 8:98953472-98953494 CAAAGTCTTCCTGAGGAGTAGGG + Intergenic
1049614468 8:143570107-143570129 TGGGGTCTTCTCGAGGAGAAAGG - Intronic
1051439729 9:17071968-17071990 CCGGGGCTTGTTGAGGGGTTGGG + Intergenic
1054706519 9:68468184-68468206 CCGGGTCTTCTTGAGGAGTAGGG - Intronic
1057260912 9:93583017-93583039 CCGGGTTTACTTTAGGAGTGAGG - Intronic
1193824093 X:86201274-86201296 CAGGGTCTTCTTGAGGGGGGTGG + Intronic
1195541956 X:106072417-106072439 TGGGGTCTACTTGAGGGGTAAGG + Intergenic
1199473662 X:148222576-148222598 CGGGGTCTACTTGAGGTGAAGGG - Intergenic
1200712246 Y:6497064-6497086 CCGGGGCTTGTTGTGGAGTGGGG - Intergenic
1201021674 Y:9664893-9664915 CCGGGGCTTGTTGTGGAGTGGGG + Intergenic