ID: 1054710379

View in Genome Browser
Species Human (GRCh38)
Location 9:68505042-68505064
Sequence TGGAACGATGAATAAGATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054710379_1054710384 17 Left 1054710379 9:68505042-68505064 CCTTTATCTTATTCATCGTTCCA 0: 1
1: 0
2: 1
3: 12
4: 184
Right 1054710384 9:68505082-68505104 TTATCCTGCTTTGCTTTTGCAGG No data
1054710379_1054710386 22 Left 1054710379 9:68505042-68505064 CCTTTATCTTATTCATCGTTCCA 0: 1
1: 0
2: 1
3: 12
4: 184
Right 1054710386 9:68505087-68505109 CTGCTTTGCTTTTGCAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054710379 Original CRISPR TGGAACGATGAATAAGATAA AGG (reversed) Intronic
900573378 1:3371032-3371054 TGGATGGATGAATAAATTAATGG - Intronic
900876246 1:5344649-5344671 TGGACAGATGAATTAGACAAAGG + Intergenic
907727287 1:57031633-57031655 TGGATCGATGAACAAGATGCTGG - Intronic
909954240 1:81758087-81758109 AAGAATGCTGAATAAGATAAAGG - Intronic
910038763 1:82821834-82821856 TGGAACCATGAATACTAAAAAGG + Intergenic
912600514 1:110927946-110927968 TTGAATGATGTATAAGATGAAGG - Intergenic
915615525 1:157034867-157034889 AGGAATGCTGAATAATATAAAGG + Intronic
916197501 1:162238218-162238240 TGGACGTATGAATAAGAGAAAGG + Intronic
917914094 1:179683598-179683620 TGCAAAGATGAATAAAATAATGG + Intronic
920044723 1:203125943-203125965 TGGAAGGATGGAGAAGATAAGGG + Intronic
921411918 1:214845152-214845174 TGGAAAGAAGTAAAAGATAAGGG - Intergenic
921623125 1:217348583-217348605 TTGAACCATGAAAAAGAAAAGGG - Intergenic
922145312 1:222938361-222938383 AGGAAAGAAGAATAAGATAGAGG - Intronic
924752763 1:246910875-246910897 TGGAAAGATGTATAAGAAACCGG + Intronic
1068736786 10:60422277-60422299 TGTATAGATGAATAAGTTAATGG - Intronic
1068880343 10:62042357-62042379 TGGAGAGATGAATAGGAGAAAGG + Intronic
1071970630 10:90902550-90902572 TTGACCTATGAATATGATAAAGG - Intronic
1074429319 10:113380109-113380131 TTGTAAGATGAAGAAGATAATGG + Intergenic
1074726712 10:116318298-116318320 TACAAAGATGAATAAGACAAGGG - Intergenic
1075650205 10:124122976-124122998 TGAAAGGATTAATGAGATAATGG - Intergenic
1075907111 10:126091155-126091177 TGGAACTATCAAAAAGTTAAAGG - Intronic
1078234802 11:9474646-9474668 TGAAAGTATGAATAAAATAAGGG + Intronic
1082681313 11:56174395-56174417 TGGAATGATCAATATTATAATGG - Intergenic
1085283978 11:75348270-75348292 TGGAAGGATGAATAGGCCAAGGG - Intronic
1085372039 11:76017951-76017973 AGGAACAAAGAATAAGAGAAAGG + Intronic
1089053094 11:115562976-115562998 AGGAATGATGAATAAGATAAGGG + Intergenic
1092312684 12:7375188-7375210 AGGAAAGATGAGTAAGAAAATGG - Intronic
1092335585 12:7629724-7629746 CGGAAAGATGAATATGAGAAGGG - Intergenic
1095710821 12:45286061-45286083 TGGAAGGTTGAACAAGAAAAAGG + Intronic
1096597045 12:52702499-52702521 TGGATTGATGAATAAGTGAATGG + Intronic
1099647894 12:85382701-85382723 TGGAAAGATGTTCAAGATAATGG + Intergenic
1100424543 12:94471793-94471815 TAGAATGATGAAAAAGAAAAAGG - Intergenic
1101038972 12:100735186-100735208 TGGTACAATGAATGAGAAAAGGG - Intronic
1104098769 12:125586227-125586249 TGGAACCATGAGTTAGATAAGGG + Intronic
1104118707 12:125775952-125775974 TGCTAAGATGAATAAGATATTGG + Intergenic
1107173341 13:37370098-37370120 TGGAACAATGAATAAATAAATGG - Intergenic
1107252759 13:38385106-38385128 CAGAAAGATGAATAAGATGAAGG + Intergenic
1108560803 13:51642068-51642090 TGGAAAGACTAATAAGAAAATGG - Intronic
1108618418 13:52158497-52158519 AGAAACGAAGAATAAGATCATGG - Intronic
1109033729 13:57229255-57229277 TAGAATGATGCATAAGAGAAAGG - Intergenic
1109613090 13:64792389-64792411 TGGAAGGATGATAAAGCTAAAGG - Intergenic
1110061210 13:71040093-71040115 TGGAATGATGTAGCAGATAAAGG - Intergenic
1110166921 13:72453403-72453425 TGGAACCATGCATAGGATGACGG + Intergenic
1110761860 13:79239658-79239680 TGGAAACATGAACAAAATAAAGG + Intergenic
1111592445 13:90367681-90367703 TGGAACAATATATAAGAAAATGG - Intergenic
1116162112 14:41281221-41281243 TGTCACCATGAATAAGCTAAAGG - Intergenic
1118000829 14:61522132-61522154 TGGAAGGATGTAAAGGATAAAGG - Intronic
1120176577 14:81300091-81300113 AGGAAAGATAAATAAGTTAATGG + Intronic
1120239625 14:81935099-81935121 TAGATCAATGAATAAGAAAATGG + Intergenic
1121504743 14:94468263-94468285 TGGATAGATGAATACGTTAATGG + Intronic
1122457986 14:101870305-101870327 TGAAACGATGAAGAAAATATAGG - Intronic
1127438752 15:58985420-58985442 TGGAAAGATAAAGAAAATAAAGG - Intronic
1127625431 15:60775772-60775794 TGGAAAGATGAATATGCTTATGG + Intronic
1131048611 15:89332376-89332398 TGGAATGAAGAATAAAAAAAGGG + Intronic
1134105917 16:11485984-11486006 TGGACAGATGAATAAGTGAATGG + Intronic
1134806433 16:17129860-17129882 TGGAAGAAAGCATAAGATAAAGG - Intronic
1134815607 16:17203366-17203388 TCGATCGATGAATAAATTAATGG - Intronic
1134864633 16:17593992-17594014 TGGAAAGATGAATAAGTTCTGGG - Intergenic
1135259248 16:20966669-20966691 TCCATCCATGAATAAGATAATGG - Intronic
1140873088 16:79124627-79124649 TGGAATGATGAATATGTTCAGGG + Intronic
1144177128 17:12718167-12718189 TTCAACGATGAATAAGACACAGG + Intronic
1146984770 17:37205055-37205077 TGGAAAGAAGAAAAAGAGAAAGG + Intronic
1147621211 17:41868487-41868509 AGGAACAATGATAAAGATAAGGG + Intronic
1147772479 17:42877592-42877614 TGGAAGGATGAAAAAGATGAAGG + Intergenic
1148637592 17:49160531-49160553 TGGAGGGAGAAATAAGATAATGG - Intronic
1151022989 17:70640878-70640900 TGAAACGCTGAAAAAGTTAATGG - Intergenic
1156000240 18:32377233-32377255 TAGAATCAGGAATAAGATAAGGG - Intronic
1156920681 18:42518864-42518886 TGAAATGATGAATAAAATGAAGG - Intergenic
1159033035 18:63250627-63250649 TGGAAAGATGAATATGAAAAAGG - Intronic
1159525409 18:69582659-69582681 TGGAAAGATGAATGGGATTAAGG - Intronic
1159649838 18:70965063-70965085 TTGAAGGATGAATAAGGTACTGG + Intergenic
1160406164 18:78647734-78647756 CAGAATGAAGAATAAGATAATGG + Intergenic
1165604645 19:37091280-37091302 TTGAAGGATGGAAAAGATAAAGG - Intronic
1166596796 19:44057472-44057494 TGGAACCCTGAAATAGATAATGG + Intronic
925488260 2:4361499-4361521 TGTAAGGATGAATATGACAAGGG + Intergenic
925495427 2:4443451-4443473 TTGAACAATGAAAAAGTTAATGG + Intergenic
926942791 2:18155643-18155665 TGTAAGGAGGAAAAAGATAATGG - Intronic
928834779 2:35530398-35530420 TGTAACGATGTATAAGTAAATGG + Intergenic
930302598 2:49635970-49635992 TGGATGGATTAATAAGAGAAAGG - Intergenic
931668882 2:64629125-64629147 TGGAAAGATGAATACGGTACAGG - Intergenic
932177903 2:69619443-69619465 TGGATGGATGAATAAGATCAAGG - Intronic
933107109 2:78344356-78344378 TGGAACTATGCATCTGATAAAGG - Intergenic
933433733 2:82217710-82217732 TGGAAGGAAGAAAATGATAATGG - Intergenic
939759716 2:146159467-146159489 TTGAAATATGAATAAGATGAGGG - Intergenic
940047702 2:149427045-149427067 TGGAAACATGAATAAAAGAAAGG + Intronic
941335983 2:164244543-164244565 TGGCACCATGAATAAGGAAAAGG - Intergenic
942117003 2:172737765-172737787 TGGATAGATCAATAAGTTAAGGG + Intronic
942750753 2:179284328-179284350 TGGAAGGAAAAAGAAGATAATGG - Intergenic
943463061 2:188193633-188193655 TGGGACGATGAATAAAGTAAGGG - Intergenic
943784596 2:191863226-191863248 TTGAAGGATGAAAAAGAGAATGG - Intergenic
944052278 2:195484016-195484038 TGGAAAGATGAATAAGACATAGG + Intergenic
944402800 2:199347550-199347572 TGCAAAGAGGAAAAAGATAATGG - Intronic
945247324 2:207730429-207730451 TTGAAAGATGAAAAAGACAAAGG - Intronic
947404940 2:229765431-229765453 TTGAAGGAGGAATAAGCTAAAGG + Intronic
1175236169 20:57513830-57513852 TGGAAAGAGAAATAAGATCATGG + Intronic
1177023291 21:15890278-15890300 TGGAATTATGAAAGAGATAAGGG - Intergenic
1179499411 21:41797870-41797892 TCAAAAGATCAATAAGATAAGGG + Intergenic
1181536811 22:23550547-23550569 TGGAAAGATGAATGAGAAGATGG - Intergenic
1181536864 22:23550860-23550882 TGGAAAGATGAATAGGAGGATGG - Intergenic
1181537130 22:23552226-23552248 TGTAAAGATGAATAAGAGGATGG - Intergenic
1182918981 22:34062092-34062114 TGGAAAGATTAAAAAGAAAAAGG - Intergenic
1183159254 22:36100633-36100655 TAGAAAGATAAATAAGAAAAAGG + Intergenic
1183663045 22:39232795-39232817 GGGAACGATGAATAAGAGTCAGG - Intronic
949396494 3:3619849-3619871 TGCAACGATGCATTAGATACTGG - Intergenic
950453148 3:13076856-13076878 TGGAACGGGGAATAAGATTTAGG - Intergenic
950805126 3:15595155-15595177 TAGAACAATGATTAAGAGAATGG - Intronic
951393240 3:22132488-22132510 GGGAACTAAGAATAAGATATAGG + Intronic
952776187 3:37048690-37048712 TGGAATGATAAAGATGATAAGGG + Intronic
955037585 3:55283959-55283981 TGGAATGATAAAGAAGATTAGGG - Intergenic
956913847 3:73850104-73850126 TTGAAAGATGAATAAAATAAGGG + Intergenic
960766155 3:121132635-121132657 TTAAACAAAGAATAAGATAATGG + Intronic
961709657 3:128818271-128818293 TGGCAGGATGAATAAGGTTAAGG - Intergenic
962156724 3:132956243-132956265 AGGAATGATAAATAAGGTAAAGG + Intergenic
962173492 3:133127715-133127737 TGAAACAATGAGAAAGATAAAGG - Intronic
963657831 3:148081426-148081448 GGGAATGAGGAAGAAGATAAGGG + Intergenic
964790228 3:160447011-160447033 TGGGAAGATGAAAAAGTTAACGG + Intronic
973174524 4:47188159-47188181 TGAAAGAATGAATTAGATAAAGG + Intronic
974308904 4:60177898-60177920 TGGAAGTATGAATAAGGGAATGG + Intergenic
975976035 4:80097799-80097821 TGGAAAGATGAATAAAAACAAGG - Intronic
976492235 4:85685016-85685038 AGAAACTAGGAATAAGATAATGG + Intronic
976692050 4:87878907-87878929 TAGAAGGATGAATGAGAGAAAGG + Intergenic
978932471 4:114331777-114331799 TGCAAAGATGAATAATATATGGG + Intergenic
979816722 4:125115755-125115777 AGGAAAGAAGAATAAAATAAGGG - Intergenic
980283074 4:130746018-130746040 AGGCAAGATGAAGAAGATAAGGG + Intergenic
981721809 4:147809399-147809421 TGGAACCATTAAAAAGAAAAAGG - Intronic
984559231 4:181249354-181249376 AGGAAAGAAGACTAAGATAAGGG + Intergenic
986839947 5:11685014-11685036 TTGCACTATGAATAAGATGAAGG - Intronic
988356824 5:30187333-30187355 TGCAACAATGAATAATACAAGGG + Intergenic
990481232 5:56213323-56213345 TGGAAGGATGCATAAGACATTGG + Intronic
992387089 5:76295046-76295068 TGGAATGATGAGAAAGATATTGG + Intronic
993879098 5:93342209-93342231 TGGAAGGATGAAGAAGACATTGG - Intergenic
994796392 5:104306176-104306198 TGGAATGAGGAATAAGGAAAAGG + Intergenic
999379635 5:151111064-151111086 TGGAACTCTGAATATGCTAAAGG - Intronic
999596651 5:153212517-153212539 TGCAACGATGCATAAGATGCCGG - Intergenic
999941390 5:156547122-156547144 TGGAAGGATGAACAAGACACTGG - Intronic
1000083389 5:157868135-157868157 TGGGACGCTGACTAACATAAGGG + Intergenic
1002679114 5:180947650-180947672 TGGAACCATGAATAAGGCACCGG - Intronic
1002684942 5:181002810-181002832 TGGAACCATGAAGAAGGTATGGG - Intronic
1004869862 6:19893957-19893979 TGGAAAGAACAAAAAGATAAAGG - Intergenic
1005719267 6:28585030-28585052 TGGAACAAGGAATAAGGAAATGG - Intronic
1008515150 6:52311824-52311846 TGTAAGGATTAATGAGATAAAGG - Intergenic
1009401066 6:63256239-63256261 TGGAAAGAAGAAAAAGATCAGGG - Intergenic
1009851354 6:69203392-69203414 AGGAAAGAAGAACAAGATAAAGG - Intronic
1010799719 6:80161480-80161502 TGAAAGGATAAATTAGATAAGGG - Intronic
1013736598 6:113234369-113234391 TGGAATGATGAATATGTTACAGG + Intergenic
1014105229 6:117553443-117553465 TGAAAGGAAGAAGAAGATAAAGG - Intronic
1015444703 6:133289530-133289552 TGAAACAATTAAGAAGATAAAGG + Intronic
1017289917 6:152723997-152724019 AGGAATGATGGATAATATAAGGG - Exonic
1018557179 6:165061768-165061790 TGGAAGGGAGAAGAAGATAAAGG - Intergenic
1019939213 7:4276053-4276075 TGGAAAGATGAACAAGAAATTGG + Intergenic
1021015934 7:15533255-15533277 TAGATTGATGAATAAGAGAATGG - Intronic
1021191525 7:17625757-17625779 TGAATCAATGAATAAGGTAAAGG + Intergenic
1024549928 7:50554223-50554245 TGGGAAGATGAATGAGATGATGG + Intronic
1025873666 7:65459688-65459710 TGTAAGGATGAATGAGATGAAGG + Intergenic
1025960829 7:66219901-66219923 TGCAACGAAAAATAAGGTAAAGG - Intronic
1027567282 7:79811633-79811655 AGGAACAATGAAAGAGATAAGGG - Intergenic
1028713440 7:93937089-93937111 TGAAACAATGAATAAGATATAGG + Intergenic
1028966025 7:96802141-96802163 TGGAAATATAAATAGGATAAAGG + Intergenic
1031753288 7:125605360-125605382 TGTGAGGATGAATAAGATACTGG - Intergenic
1032766976 7:135003996-135004018 TAAAATGAAGAATAAGATAAAGG - Intronic
1032923029 7:136571338-136571360 TGGAACAAAGAATAAACTAAAGG - Intergenic
1033033613 7:137849577-137849599 TGGAAGGATACATAAGAAAATGG + Intergenic
1033127100 7:138715947-138715969 TGCAAAGATGAATAAGACATGGG + Intronic
1037215708 8:16448729-16448751 TGGCATGATGACTCAGATAAGGG - Intronic
1038018340 8:23533097-23533119 TGGAACGAGGAATCAAAAAAGGG + Intronic
1039356736 8:36826147-36826169 TGGAACAATAAAAAAGAAAAAGG - Intronic
1039811322 8:41051110-41051132 TGGAATGATGAATAGAATAGTGG + Intergenic
1041609608 8:59829917-59829939 TGAAATGATGAATAAAGTAATGG - Intergenic
1042242633 8:66679976-66679998 TGGACAGATGAATAAGTGAAAGG - Exonic
1042344838 8:67716816-67716838 TACAGTGATGAATAAGATAAAGG - Intronic
1043544141 8:81296165-81296187 TAGAAAGATAAATAAGAAAAAGG - Intergenic
1044852408 8:96441970-96441992 TGGGAGGATGAATAAGAAGAGGG + Intergenic
1046246621 8:111571984-111572006 TGGTAGAATGAATAACATAAAGG + Intergenic
1046274273 8:111937099-111937121 TAGAATGATGAATATGATATTGG - Intergenic
1046538450 8:115547737-115547759 TGGAGAGATGGCTAAGATAAAGG - Intronic
1048184080 8:132223194-132223216 AGGAAGGATGGAAAAGATAAGGG + Intronic
1049231507 8:141487190-141487212 AGGAAGGATGAATAAGATCAAGG - Intergenic
1050256067 9:3793475-3793497 TGTAGGGATTAATAAGATAATGG - Intergenic
1051547672 9:18294491-18294513 TGGACAGATGAATTAGACAAAGG - Intergenic
1051840603 9:21393177-21393199 TGGAAAGAAGAAAAAAATAATGG + Intergenic
1053120654 9:35545229-35545251 TTAAATGATGAATAAGAGAAAGG + Intronic
1053470436 9:38342438-38342460 TGAAGAGATGAATAAGATAAGGG - Intergenic
1054710379 9:68505042-68505064 TGGAACGATGAATAAGATAAAGG - Intronic
1059369592 9:113816614-113816636 AGGAAAAATGAATAAGGTAAAGG + Intergenic
1059821837 9:117982321-117982343 TGGAAGGAAGAAAAAGATAGTGG - Intergenic
1061197410 9:129114580-129114602 TGAAACTTTGAAAAAGATAAGGG - Intronic
1061244831 9:129396179-129396201 TGAAAAGATGGATAAGAGAATGG + Intergenic
1186239366 X:7549886-7549908 TGGAAGAATGAATAAGGGAAAGG - Intergenic
1187019503 X:15365679-15365701 TGGAATAATGAAAATGATAATGG - Intronic
1188117208 X:26259396-26259418 TAGACCGATGAAAAAGAAAATGG - Intergenic
1188598562 X:31931970-31931992 AGGAACTATGAATAACCTAATGG + Intronic
1189122728 X:38412387-38412409 TGGAATGAGGAAAAAGAGAAGGG - Intronic
1189667843 X:43376576-43376598 TGGAAGGAAGAAGAAGAGAATGG + Intergenic
1194906978 X:99589882-99589904 TAGAACAATGAATAGTATAAAGG + Intergenic
1195647240 X:107246269-107246291 TGGAACAAAAAATGAGATAAAGG - Intergenic
1195928071 X:110046333-110046355 TGGAAAGAGGAATAAGCAAAAGG - Intronic
1198159489 X:133992998-133993020 TGTAAGGATGAATGAGATGAAGG - Intergenic
1198170529 X:134101003-134101025 TGGAAAAATGAAAAAGCTAATGG + Intergenic