ID: 1054710382

View in Genome Browser
Species Human (GRCh38)
Location 9:68505062-68505084
Sequence TAATTCTGCCATGAGGCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 141}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054710382_1054710387 15 Left 1054710382 9:68505062-68505084 CCAGTGGCCTCATGGCAGAATTA 0: 1
1: 0
2: 1
3: 12
4: 141
Right 1054710387 9:68505100-68505122 GCAGGAAAGGAGACTGAGTCAGG No data
1054710382_1054710386 2 Left 1054710382 9:68505062-68505084 CCAGTGGCCTCATGGCAGAATTA 0: 1
1: 0
2: 1
3: 12
4: 141
Right 1054710386 9:68505087-68505109 CTGCTTTGCTTTTGCAGGAAAGG No data
1054710382_1054710384 -3 Left 1054710382 9:68505062-68505084 CCAGTGGCCTCATGGCAGAATTA 0: 1
1: 0
2: 1
3: 12
4: 141
Right 1054710384 9:68505082-68505104 TTATCCTGCTTTGCTTTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054710382 Original CRISPR TAATTCTGCCATGAGGCCAC TGG (reversed) Intronic
900405033 1:2489185-2489207 TCTTTCTGCCTTGGGGCCACAGG + Exonic
906800033 1:48729116-48729138 TAATGCTGCCATGAGGCATGTGG + Intronic
909499536 1:76318643-76318665 TAATTCTGCCATAATGCTATAGG - Intronic
910378955 1:86604937-86604959 GAATTCTGTCATGAAGCCATTGG + Intergenic
911647054 1:100348746-100348768 TAATTCTGCCTGGAGGCTGCAGG - Intergenic
920006436 1:202836732-202836754 GAACTATGCCCTGAGGCCACTGG - Intergenic
920734922 1:208524868-208524890 AAATTCTGCCATGAGGGAAGAGG + Intergenic
923736113 1:236609370-236609392 TGATACTTCCATGAGGCAACTGG - Intergenic
923783814 1:237049018-237049040 AAATTCTGAGATGAGGACACCGG + Intronic
924832230 1:247609246-247609268 GAATTCAGCAATGAAGCCACTGG - Intergenic
1063464697 10:6235160-6235182 TTATTCTGTCCTGAGACCACGGG + Exonic
1065378313 10:25064630-25064652 TAGTTCAGCCAGGAGGCTACAGG + Intergenic
1066688936 10:38007677-38007699 TAATTCTGGTATGAGTCCAGAGG - Intergenic
1067003739 10:42641526-42641548 TAATTCTGGTATGAGTCCAAAGG + Intergenic
1069456684 10:68559798-68559820 TAATTCTGGCGTAATGCCACTGG + Intergenic
1076423781 10:130352622-130352644 TTATTCTGCCATTAGGCTAAAGG - Intergenic
1076816403 10:132917110-132917132 TGGTTCTGCCATGTGGCCTCCGG + Intronic
1077522417 11:3044170-3044192 AAACACAGCCATGAGGCCACGGG + Intronic
1079751291 11:24201535-24201557 TAATTCTACAATGCAGCCACTGG + Intergenic
1079965347 11:26973260-26973282 TAGTTCTCACATGATGCCACAGG - Intergenic
1083794981 11:65011082-65011104 AAATTCTACCATGTGGCCCCTGG + Intergenic
1085398663 11:76221412-76221434 TTATTCTGCCATAAAGACACAGG + Intergenic
1087021277 11:93605939-93605961 AACTTCTGACATGAAGCCACTGG - Intergenic
1087358854 11:97131670-97131692 AAATTCTGCAATGAAGCCATAGG + Intergenic
1087359445 11:97139330-97139352 TCATTCTGCCATAAAGTCACAGG - Intergenic
1088487137 11:110351706-110351728 TAGTACTGCCATGATGCCAGAGG - Intergenic
1089655433 11:119943746-119943768 TGAATCTGCCCAGAGGCCACAGG - Intergenic
1089765335 11:120759073-120759095 TACTTCGTCCAGGAGGCCACAGG + Intronic
1092053902 12:5493207-5493229 TAATTCCACCAGGACGCCACCGG + Intronic
1092288690 12:7145309-7145331 TAATACTTCCCTGAGGTCACGGG + Intronic
1093270505 12:17054415-17054437 TAATTTTGCCCTGAGGACAAAGG - Intergenic
1093347709 12:18059959-18059981 AAATTCAGCAGTGAGGCCACAGG - Intergenic
1094502101 12:31030854-31030876 CAGCTCTGCAATGAGGCCACTGG - Intergenic
1097807296 12:63979991-63980013 GAATCCTGCCATGGGGCCGCAGG - Intronic
1104493469 12:129214982-129215004 TCATTCTACCATGAAGACACAGG + Intronic
1106104360 13:26721428-26721450 GGATGCAGCCATGAGGCCACAGG - Intergenic
1109235022 13:59806086-59806108 TAACTCTGCCATAAACCCACAGG - Intronic
1110330483 13:74266596-74266618 GAATCCTTCCATGAGGCCACTGG - Intergenic
1112866449 13:103906880-103906902 TCATTCTACCATAAGGACACAGG - Intergenic
1115873099 14:37828067-37828089 AATTTCTGCCATGGGACCACTGG + Intronic
1118532832 14:66726780-66726802 GAGTGCTGCCATGATGCCACAGG + Intronic
1118562403 14:67100600-67100622 TAATTGTGCCATGGTGTCACTGG - Intronic
1118828869 14:69410283-69410305 CAATTCTGCCATGTTGCCAGGGG - Intronic
1121222647 14:92298356-92298378 TAAATCTGCCATGAAGCTGCTGG - Intergenic
1123010620 14:105347970-105347992 TCATTCCGTCCTGAGGCCACAGG - Intronic
1123434113 15:20242604-20242626 CTTTTCTGCCATGAGGACACAGG + Intergenic
1123455592 15:20421007-20421029 TCATTCTGCCATTAAGGCACTGG - Intergenic
1126803757 15:52324368-52324390 TATGTCTGCCATGAAGCCCCTGG - Intronic
1127520238 15:59736335-59736357 CACTTCTGCCATGAAACCACAGG - Intergenic
1129444822 15:75609577-75609599 CACTTCTGCCAGGAGGCAACAGG - Exonic
1130160949 15:81399433-81399455 TAATTCTGCAAAGGGGCCACTGG - Intergenic
1134893470 16:17862404-17862426 TAATTCTACAATGATGTCACAGG + Intergenic
1135505157 16:23030014-23030036 CAATTCTGGCATGAGGTCACTGG + Intergenic
1136850498 16:33608511-33608533 CTTTTCTGCCATGAGGACACAGG - Intergenic
1140269405 16:73451075-73451097 TAAGGCTCTCATGAGGCCACAGG + Intergenic
1203112112 16_KI270728v1_random:1456964-1456986 CTTTTCTGCCATGAGGACACAGG - Intergenic
1143449831 17:7029472-7029494 TAATTCTGCAGTGGGGCCATGGG - Exonic
1143480892 17:7226796-7226818 TACTTCTGCCATGAGGGCAGGGG + Intronic
1144029019 17:11303560-11303582 TGATGCTGCCATGAGGTGACGGG + Intronic
1144944148 17:18961255-18961277 TAGTGTTGCCATGAGGTCACCGG - Intronic
1144954154 17:19010794-19010816 GAGTTCTGCCATGGGGCCCCCGG + Intronic
1147384041 17:40071422-40071444 TACTTCTGCCATGGGGGGACAGG - Intronic
1150769562 17:68029753-68029775 TGATTGTCCCATGAGGCCACAGG + Intergenic
1152621788 17:81368549-81368571 TAAGGCTGCCATGGGCCCACTGG - Intergenic
1154256253 18:12783116-12783138 TAACTCTCCCATAAGACCACAGG + Intergenic
1156535287 18:37857890-37857912 GAATTCTGCAGTGAAGCCACTGG + Intergenic
1157881865 18:51328448-51328470 TAAATCTACCAAGAGGCCAAAGG - Intergenic
1159032789 18:63248273-63248295 AAAATCTGCCATCAGGCCTCTGG + Intronic
1165030334 19:32993722-32993744 CTTTTCTGCCATGAGGACACAGG + Intronic
1165649664 19:37474918-37474940 TAATGCTGCTGTGATGCCACTGG - Intronic
1167854115 19:52224454-52224476 GATTTCTGCCATGAGGCACCCGG - Intronic
925710749 2:6737384-6737406 TAAGTCTTCAATGTGGCCACTGG + Intergenic
926480287 2:13384217-13384239 TCATTCTGCCATTAAGGCACTGG + Intergenic
926516873 2:13857731-13857753 TCATTCAGCCAGGAGGCCTCTGG - Intergenic
927208632 2:20625334-20625356 TGAGTCTGCCATGCGGTCACAGG + Intronic
931572662 2:63685492-63685514 GAATTCAGCCGTGAAGCCACTGG - Intronic
932318239 2:70800802-70800824 CACTTCTGCCATGGGGTCACTGG - Intergenic
933024480 2:77237826-77237848 TACTTGTGCCCTGAGGCAACAGG - Intronic
934968140 2:98740914-98740936 GAATTCAGCCATGAGGCTGCAGG + Intergenic
937646068 2:124267428-124267450 TAATTCTGCCAACAGCTCACGGG - Intronic
937827673 2:126385293-126385315 TAATTCTGCAATGAAACCACCGG + Intergenic
938982328 2:136538618-136538640 TAATTGTGCCACGTGGCCATAGG - Intergenic
939404853 2:141743566-141743588 GAATTCAGCAATGATGCCACTGG + Intronic
939719326 2:145628531-145628553 TAATTCTTCCATGTGGCACCAGG - Intergenic
942325482 2:174772811-174772833 TACTTCTGCCAGGGGTCCACTGG - Intergenic
942979181 2:182058426-182058448 TAATTCTGCCAGGTGACCAAGGG - Intronic
943184634 2:184591831-184591853 TAAAACTGCCATGAGGTTACAGG + Intergenic
943578554 2:189658313-189658335 TAATTCTGCCAGAAGGTGACAGG - Intergenic
948607931 2:239147653-239147675 CAACTCTTCCATGAGGCCTCCGG - Intronic
1172238332 20:33393918-33393940 TCCTACTGCCATGGGGCCACTGG + Intronic
1172385956 20:34534397-34534419 TCATTCGCCCATGAGGCAACAGG - Intronic
1173618587 20:44419154-44419176 TAACTATGCCATGAAGGCACAGG - Intronic
1173741467 20:45405630-45405652 TACTTCTGCCTTGGGGTCACTGG - Intronic
1174447122 20:50597775-50597797 CAAGTCTGCCGTGAGGCCCCTGG - Intronic
1175470519 20:59223906-59223928 AAAGGCTGCCAGGAGGCCACGGG + Intronic
1177854849 21:26389024-26389046 TCATTCTGCCCTGAGGTCCCAGG - Intergenic
1183038369 22:35157589-35157611 TAATTCTGCTGGGAGGCCTCAGG - Intergenic
1183946744 22:41330620-41330642 TAATCCTCCCATGAGCCCTCTGG - Intronic
1184967423 22:47990904-47990926 GAATTATGCCAGGAGGCCGCTGG + Intergenic
949712422 3:6886948-6886970 TAATTCTGACCTGAGTTCACGGG - Intronic
953702990 3:45210927-45210949 AAATTCTGACATCTGGCCACAGG - Intergenic
955713733 3:61806693-61806715 TAATTCAGCCATGGGCCCATCGG - Intronic
957799354 3:85055085-85055107 TACTTCTGCCATGACCCCACAGG + Intronic
961329387 3:126129756-126129778 TACTCCTGCCCTGGGGCCACTGG + Intronic
961710939 3:128827720-128827742 TCATAGGGCCATGAGGCCACTGG + Intergenic
963081179 3:141394964-141394986 TAAAGCTGCCTTGAGGTCACAGG + Intronic
964254228 3:154757171-154757193 AAATTCTGCCATGAAACCATGGG - Intergenic
971672449 4:29580245-29580267 TAATTCACCCATGAAGCCATTGG - Intergenic
983022065 4:162689646-162689668 TAATTCTGCGATGAAACCATGGG - Intergenic
986489058 5:8270766-8270788 CAATTCTGTCATGATGCCTCCGG - Intergenic
993955789 5:94230946-94230968 TATTGATGCCATGAAGCCACAGG + Intronic
995978755 5:118075787-118075809 TGATTCTCCCATGTGGCCCCTGG - Intergenic
1000491563 5:161920989-161921011 CAATTCGGCCATGAAGGCACAGG + Intergenic
1003357377 6:5386473-5386495 TAATTCTGCAATGTGGCCAGTGG + Intronic
1004421714 6:15476347-15476369 CACCTCTGCCATGAGGCCAGAGG - Intronic
1005825447 6:29628994-29629016 AAATTCTGCCCTTAGGCTACGGG - Intronic
1010020464 6:71154046-71154068 CAATTCTGCCATGGGGACTCTGG + Intergenic
1013587186 6:111590045-111590067 TAAATCTCCGCTGAGGCCACTGG - Intronic
1014672725 6:124326821-124326843 TAATTCTACCAGGAGGGCATAGG + Intronic
1016669281 6:146682987-146683009 TAATTAGGCCATGAGGACAGAGG + Intronic
1016864279 6:148749518-148749540 TAATTCTGCCATGAAACACCAGG - Intronic
1018562391 6:165115409-165115431 TAGTTCTGTAAAGAGGCCACAGG - Intergenic
1019443793 7:1060563-1060585 GAATTCAGCCACGAGGTCACTGG + Intronic
1022106482 7:27200634-27200656 TATTTCTGCAGTGAGACCACAGG + Intergenic
1022750148 7:33216125-33216147 TATTTCTGACACTAGGCCACTGG + Intronic
1027535876 7:79400535-79400557 GAATTCTGCAGTGAAGCCACAGG - Intronic
1027943264 7:84712116-84712138 TATTTCTGCCATGAGTTCATAGG + Intergenic
1030027380 7:105337606-105337628 TAATCCTATCATGAGGCCAGTGG - Intronic
1030686484 7:112492459-112492481 GTATTCTGCCATGAGGACCCTGG + Intergenic
1032606151 7:133356040-133356062 TACTTCTGCCATGAGTCCACTGG - Intronic
1033772519 7:144568213-144568235 TAATTCAGCAATGAGGCCATTGG - Intronic
1034594492 7:152176647-152176669 TAATTCAGACATTAGGCCATCGG - Exonic
1038560880 8:28578720-28578742 TACTTCTGCCATGAGGACTGAGG + Intergenic
1039789960 8:40867612-40867634 ACAGTCTGCCTTGAGGCCACTGG + Intronic
1041156944 8:54997374-54997396 TCACTTTGCCCTGAGGCCACAGG + Intergenic
1042233482 8:66583851-66583873 GAATTCTGCAATGAAGCCATTGG - Intronic
1048034261 8:130662296-130662318 TCATTCTGCTAAGTGGCCACTGG + Intergenic
1049668027 8:143856821-143856843 CATTTCTGCCCTGAGGCCACTGG + Intergenic
1051368345 9:16337188-16337210 TAATAATGCCATGAAGCCTCTGG + Intergenic
1051852465 9:21525651-21525673 TAATTCTGTCATAAAGACACAGG - Intergenic
1052028984 9:23607091-23607113 TAATTAGGCCATGAGGTCAGAGG - Intergenic
1052118976 9:24685238-24685260 TGATTCTTCCATTAGGCCTCTGG - Intergenic
1052515547 9:29474690-29474712 TTACACTGCCATGTGGCCACTGG - Intergenic
1054710382 9:68505062-68505084 TAATTCTGCCATGAGGCCACTGG - Intronic
1056206725 9:84326543-84326565 CAATTCAGCCATGAAGCCACAGG - Intronic
1058787404 9:108403886-108403908 TAATTCTGCCAGTTGGCCATGGG - Intergenic
1059365254 9:113781778-113781800 TCATTCTGTGATGAGACCACTGG - Intergenic
1185749876 X:2602360-2602382 TAATTCTGCCTTGAGGTCTCTGG - Intergenic
1192337884 X:70237131-70237153 AACTTCTGCACTGAGGCCACAGG + Exonic
1195232710 X:102867295-102867317 TATTTGTCCCATCAGGCCACTGG + Intergenic
1196947072 X:120837951-120837973 TAATTCTACCATGACACCATGGG - Intergenic
1197719473 X:129735390-129735412 GAATTCTGCCCTGAGGGCAGTGG + Intergenic
1200069638 X:153521689-153521711 AAGTTCTCCCCTGAGGCCACAGG + Intronic
1202372921 Y:24210409-24210431 TTTTTCTGGGATGAGGCCACTGG + Intergenic
1202497861 Y:25459711-25459733 TTTTTCTGGGATGAGGCCACTGG - Intergenic