ID: 1054710383

View in Genome Browser
Species Human (GRCh38)
Location 9:68505069-68505091
Sequence AGCAGGATAATTCTGCCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 140}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054710383_1054710388 27 Left 1054710383 9:68505069-68505091 CCTCATGGCAGAATTATCCTGCT 0: 1
1: 0
2: 0
3: 19
4: 140
Right 1054710388 9:68505119-68505141 CAGGAAGCAATTCAGATTCATGG No data
1054710383_1054710386 -5 Left 1054710383 9:68505069-68505091 CCTCATGGCAGAATTATCCTGCT 0: 1
1: 0
2: 0
3: 19
4: 140
Right 1054710386 9:68505087-68505109 CTGCTTTGCTTTTGCAGGAAAGG No data
1054710383_1054710384 -10 Left 1054710383 9:68505069-68505091 CCTCATGGCAGAATTATCCTGCT 0: 1
1: 0
2: 0
3: 19
4: 140
Right 1054710384 9:68505082-68505104 TTATCCTGCTTTGCTTTTGCAGG No data
1054710383_1054710387 8 Left 1054710383 9:68505069-68505091 CCTCATGGCAGAATTATCCTGCT 0: 1
1: 0
2: 0
3: 19
4: 140
Right 1054710387 9:68505100-68505122 GCAGGAAAGGAGACTGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054710383 Original CRISPR AGCAGGATAATTCTGCCATG AGG (reversed) Intronic
901971535 1:12912527-12912549 AGCAGGACAACTCTCCCAGGTGG + Intronic
902013633 1:13289213-13289235 AGCAGGACAACTCTCCCAGGTGG - Intergenic
907494954 1:54837529-54837551 AGCAGGGTACTGCTGGCATGTGG + Intronic
910434406 1:87190649-87190671 ACAAGGATAATGCTGCAATGAGG - Intergenic
911010264 1:93273525-93273547 AGCCAGATAGTTCTGTCATGTGG + Intronic
911115407 1:94241082-94241104 GGCAGGATAATTCTTTCTTGGGG - Intronic
913326112 1:117630286-117630308 AGAAGGATAGGTCTGCCAGGAGG - Intergenic
915082104 1:153359407-153359429 TGGAGGATAGTTTTGCCATGCGG - Intronic
917346460 1:174033260-174033282 AGAAGGTAAATTCAGCCATGTGG - Intergenic
918161656 1:181906549-181906571 AGCATAATATTCCTGCCATGGGG - Intergenic
919190837 1:194216510-194216532 AGCAGGAACATTGGGCCATGTGG + Intergenic
921106944 1:211990904-211990926 GGCAGGATAATTCTGGCAAATGG + Intronic
922983388 1:229847694-229847716 CGAAGGATACTCCTGCCATGGGG - Intergenic
1063718955 10:8558994-8559016 TGCAGGATGATTCTTCCTTGGGG - Intergenic
1065619890 10:27570124-27570146 AGCAGCAAAGCTCTGCCATGTGG - Intergenic
1065800011 10:29343786-29343808 AGCAATATAATTCTGCTGTGTGG - Intergenic
1068720206 10:60236835-60236857 AGCAGAATATATTTGCCATGTGG - Intronic
1071985904 10:91050069-91050091 AGCAGGATAAATCAACCTTGTGG + Intergenic
1079360416 11:19766144-19766166 ATAAGGACAATTCTGCCATGTGG + Intronic
1079679594 11:23278293-23278315 AGTAGGAAGATTCTTCCATGTGG + Intergenic
1079710112 11:23672233-23672255 AGGAGGATAATACTACCATGGGG - Intergenic
1079913214 11:26336564-26336586 AGCAGGATAGTTGTGCCAAGTGG - Intronic
1081207856 11:40294926-40294948 AGCAGGATAATCTTACCAGGAGG + Intronic
1083019341 11:59490351-59490373 AGCAGGAAAATTCTTCCTTTTGG + Intergenic
1085123867 11:73984018-73984040 GGCAGATTATTTCTGCCATGAGG + Intergenic
1091995441 12:4989223-4989245 AGCTGGATAATTCTTGCTTGTGG - Intergenic
1092940951 12:13406495-13406517 AGCTGCACAATTCTGCCATCTGG - Intergenic
1096964861 12:55617890-55617912 AGCTGGGGAGTTCTGCCATGGGG - Intergenic
1099657632 12:85514622-85514644 GGCATGATAATACTGCCATGTGG - Intergenic
1100727002 12:97419226-97419248 GGCAGGATAATTCTTCGTTGTGG - Intergenic
1103852300 12:123941076-123941098 AGCAGCATAGTTTTGCCCTGTGG - Intronic
1104166930 12:126240722-126240744 AGGAGTCTAACTCTGCCATGGGG - Intergenic
1105774874 13:23649040-23649062 AGCCAGATAAAGCTGCCATGAGG - Intronic
1105802143 13:23915798-23915820 AGCATAAGAATTCTGGCATGAGG + Intergenic
1106760241 13:32860552-32860574 AGCAGGATAATTCTGCAGAATGG + Intergenic
1107338533 13:39381562-39381584 AGTGGGAGGATTCTGCCATGGGG - Intronic
1109187454 13:59287663-59287685 AGCAGAATATTCCTGCCAGGAGG - Intergenic
1113532147 13:111035942-111035964 AGCTGGAGAATTCTGTCGTGGGG + Intergenic
1116144972 14:41054115-41054137 ATCAGGGTAATTCTTCCATGTGG + Intergenic
1116761280 14:49018322-49018344 AGGTGGATAATTCTCTCATGAGG - Intergenic
1118072440 14:62260597-62260619 GGCTGGATAAGTCTGTCATGTGG + Intergenic
1118501462 14:66366105-66366127 AGCAGGGTAATTTACCCATGTGG + Intergenic
1119865244 14:77967740-77967762 AGTAGAATAATGCTGCCAAGTGG - Intergenic
1120508884 14:85388293-85388315 TGCAGAATAATTATGCCATTAGG - Intergenic
1122060365 14:99133075-99133097 ACCAGGAGACTTCTGCGATGGGG - Intergenic
1129254980 15:74329294-74329316 AGCCGTGCAATTCTGCCATGAGG - Intronic
1130428630 15:83824114-83824136 AGGAGGATGAGTCTGCAATGAGG - Intronic
1133579842 16:7132849-7132871 AGCAAGAGAATGCTGCCACGTGG + Intronic
1138000143 16:53269888-53269910 AGCAGGATATTTCTTCATTGTGG - Intronic
1140154624 16:72410792-72410814 AGCAGGTTAATTCTTCCTTCAGG - Intergenic
1140233181 16:73134726-73134748 AGAAGGATAATCCTCCCATAAGG - Intronic
1142502974 17:343786-343808 GGCTGGATAACTCTGTCATGGGG - Intronic
1149393667 17:56217539-56217561 AAGAGGATAATACTGGCATGTGG + Intronic
1150601529 17:66654981-66655003 AGCAGGATGAGTCTCCAATGGGG - Intronic
1153120884 18:1725341-1725363 AGCACCAGAATTCAGCCATGGGG + Intergenic
1153759162 18:8313529-8313551 TGCAGGAAAATTCTGCCCTTAGG + Intronic
1158568577 18:58576728-58576750 AGCAGGAAAATTTTGCCACAGGG - Intronic
1158731521 18:60029573-60029595 AGCAGAATGGTTGTGCCATGTGG + Intergenic
1166799103 19:45444792-45444814 AGATGGATTATTCTGCCATCAGG - Intronic
925517954 2:4705874-4705896 ATCAGGCTAATTCTGCCACAAGG + Intergenic
925919586 2:8629656-8629678 AGCAGGAGAATCCAGCCCTGGGG + Intergenic
926742183 2:16121185-16121207 AGTAGGATACTTGAGCCATGAGG - Intergenic
929878291 2:45815081-45815103 CACAGGGTAATTCTCCCATGGGG - Intronic
931242479 2:60465997-60466019 AGCAGGTTAATGCCGCCAAGTGG + Intronic
931656611 2:64514745-64514767 AGCAGGTCAGTTCTCCCATGGGG + Intergenic
934782433 2:96979968-96979990 AACAGGAGAATTCTGACATGTGG - Intronic
936873970 2:117166122-117166144 AGCAGGATAAGGTTTCCATGTGG - Intergenic
939138327 2:138323348-138323370 ATCAAGATGCTTCTGCCATGAGG - Intergenic
939459681 2:142483733-142483755 TGCAGGATATTTCTGCCTTAGGG - Intergenic
946140245 2:217684186-217684208 ACCAGGATAAGACTGACATGTGG + Intronic
946682937 2:222236379-222236401 AACTGGATGATTCTGCCAGGTGG - Intronic
948347336 2:237309716-237309738 AGCAGGATTGTTCTGCCTTGAGG + Intergenic
1168891835 20:1300003-1300025 AGCAGGATACATCTCCCAGGTGG - Intronic
1170052062 20:12156836-12156858 AGCTGGTTGAGTCTGCCATGGGG + Intergenic
1172816029 20:37687042-37687064 AGCAGGATAGTTCTGGCTTAGGG - Intergenic
1173560281 20:44000218-44000240 AGCAGGATAATTCTGGCCCTGGG + Intronic
1174051818 20:47772247-47772269 GGCAGGATCATTCTTCGATGGGG + Intronic
1178315103 21:31560435-31560457 AGAAGGATCATTCTGCAAAGTGG - Intergenic
1182331547 22:29554708-29554730 AGGAGGGTAGATCTGCCATGTGG + Intronic
1182737260 22:32539758-32539780 AGCAGAAAAATGCTGCAATGAGG + Intronic
955103324 3:55873060-55873082 AGCTGGATAATTCTTTCTTGTGG - Intronic
956127816 3:66027788-66027810 GGCTGGATAATTCTCCCTTGAGG + Intronic
956848175 3:73203063-73203085 CACAGGAAAATTCTGACATGTGG - Intergenic
957139925 3:76340906-76340928 TTCAGGATAAGTCTGCCATTTGG + Intronic
958185806 3:90117929-90117951 AGCAGGAGACTGCTGCTATGGGG + Intergenic
958455878 3:94330253-94330275 AGCAGGATAACTCCTCCAAGAGG + Intergenic
960465042 3:117987641-117987663 TGCAGGATAACTTTGACATGTGG - Intergenic
964474484 3:157086219-157086241 AGTGGGATAATGCTGCAATGAGG - Intergenic
964695011 3:159497549-159497571 GGCATCTTAATTCTGCCATGTGG - Intronic
964814839 3:160705969-160705991 AGCCGGCAAATACTGCCATGAGG - Intergenic
966253919 3:177896855-177896877 AGCAGGCAATTTCTCCCATGGGG + Intergenic
969356926 4:6633464-6633486 AGCTGGTAAATGCTGCCATGAGG - Intergenic
969857100 4:10008791-10008813 ATCAGCATAAATCTGCCATGTGG + Intronic
971153628 4:24059740-24059762 AGGAGGAAAATTCTCCCATAGGG - Intergenic
971994705 4:33950249-33950271 AGCAGGTTAATTTTGGCATGAGG - Intergenic
972226345 4:37017262-37017284 TGCAGGTTAATTTTGCCATGTGG + Intergenic
976124133 4:81815419-81815441 AGCCTGAAAATTCTGCCAAGAGG + Intronic
979048079 4:115895196-115895218 ATCAGGATAATTGTGCATTGGGG + Intergenic
979916410 4:126440134-126440156 AGCAGAATAACACTGCAATGTGG - Intergenic
980183442 4:129431080-129431102 TTCAGGATTATTCAGCCATGTGG - Intergenic
981735668 4:147947864-147947886 AGCAGGATAATAGAGCCATGAGG - Intronic
985793599 5:1946043-1946065 AGCAGGAAAAGTCTTCCCTGAGG + Intergenic
986296736 5:6445769-6445791 GGCAGGAGAATCCTGCCAGGAGG - Intergenic
986331233 5:6717361-6717383 AGCAGGCTCATCCTCCCATGAGG - Intronic
990299030 5:54432280-54432302 AGGTGGATAATTCTGGCTTGGGG + Intergenic
992177431 5:74164193-74164215 ATCAGGATAATGCTGGCCTGGGG + Intergenic
993831232 5:92761022-92761044 AGCAGAGTAATTCTGTAATGTGG - Intergenic
995446807 5:112253992-112254014 AGCCGGAGAGTTCTGCCAAGTGG + Intronic
1000047982 5:157537035-157537057 AGCTGGATAATTCTGTTGTGGGG + Intronic
1000636106 5:163645403-163645425 AGCAGGAAAGTTCTCCCATGTGG - Intergenic
1001740794 5:174051255-174051277 GGCAGGATAATTCTACCCAGGGG - Intronic
1002525911 5:179816134-179816156 AGGAGGATAATTCTTCCAGAAGG + Intronic
1003357376 6:5386466-5386488 AGAAAAATAATTCTGCAATGTGG + Intronic
1006685504 6:35829856-35829878 AACAGTCTAATTCTGCCATTTGG + Intronic
1009980317 6:70719826-70719848 AGCAAGATAATTGAACCATGGGG - Intronic
1010794500 6:80103745-80103767 AGCAGGATGCTTCTCCCATGTGG - Intergenic
1011391591 6:86859437-86859459 GGCTGGATAATTCTGCTATTTGG - Intergenic
1015306950 6:131719982-131720004 ATCAGCATAATTCTGCAATATGG - Intronic
1018172162 6:161151906-161151928 AGCAGGATAATTCTGGCCCTTGG + Intronic
1018309080 6:162489959-162489981 AGCAAGAAAATGCTGGCATGAGG + Intronic
1020497410 7:8873528-8873550 AGCAGTATAATACTACCATTTGG - Intergenic
1021640811 7:22734607-22734629 ACCAGGAGGATTCTGCAATGGGG + Intergenic
1021813088 7:24422855-24422877 AGGTGGATAATTCTCCCAGGTGG - Intergenic
1023915455 7:44585288-44585310 AGCTGGATAATTCTTCGCTGTGG - Intergenic
1025093256 7:56079993-56080015 ACCAGGAAAATTCTGCCTTGAGG - Exonic
1026939351 7:74278015-74278037 AGCTGGGTCATTCTGCTATGGGG - Intergenic
1031415071 7:121485861-121485883 ATCAGGCCAATTCTGTCATGAGG + Intergenic
1032302986 7:130707013-130707035 AGTAGGAAAATACTCCCATGGGG + Intergenic
1034074016 7:148214524-148214546 AGAAGGATAGTTTTGGCATGTGG + Intronic
1038741509 8:30220924-30220946 AGCAGGATAATTCCGACTTGAGG + Intergenic
1038841643 8:31189685-31189707 AACTGGAGAATTCTGCAATGGGG - Intergenic
1043612227 8:82078892-82078914 ATCAGGATAATTCTGACTTCAGG - Intergenic
1045013523 8:97979097-97979119 AGCAATATAATTATGTCATGGGG + Intronic
1046310180 8:112425568-112425590 AGCAGCATAAGTCTCCCTTGGGG - Intronic
1047945079 8:129868856-129868878 AGCAGAATAATTCTCCCAATGGG + Intronic
1048328358 8:133455567-133455589 ATCAGGATTATCCTGCCCTGTGG - Exonic
1050133866 9:2441423-2441445 ATCAGGGTTATTCTGCCATGAGG + Intergenic
1050534241 9:6618016-6618038 AGCAGGATCATCATGACATGAGG - Intronic
1053533378 9:38903639-38903661 AAGCGGATAATGCTGCCATGGGG - Intergenic
1054205605 9:62128068-62128090 AAGCGGATAATGCTGCCATGGGG - Intergenic
1054632756 9:67460302-67460324 AAGCGGATAATGCTGCCATGGGG + Intergenic
1054710383 9:68505069-68505091 AGCAGGATAATTCTGCCATGAGG - Intronic
1054928214 9:70609621-70609643 GGCAGGATAATTCTTCATTGTGG - Intronic
1055157269 9:73079648-73079670 CACTGGATAATTCAGCCATGAGG + Intronic
1055182228 9:73402235-73402257 AACAGTATTATTCTGCCAAGAGG + Intergenic
1055876520 9:80949361-80949383 AGCAGGAAAATATTGCCAGGTGG - Intergenic
1056522010 9:87410645-87410667 AGCATGGTTATTCTGCCTTGTGG - Intergenic
1056659161 9:88532287-88532309 AGCAGTATAAATCTTGCATGAGG - Intergenic
1057616070 9:96591444-96591466 AGCAGTATGATACTGGCATGAGG - Intronic
1060769149 9:126318354-126318376 AGCAGTCTGATTCTGCCATGTGG + Intergenic
1060858268 9:126933263-126933285 AGCAGGTTAAAGCTGCCATGAGG + Intronic
1187244670 X:17543220-17543242 ATAAGGATAATGCTGCCCTGTGG - Intronic
1192631505 X:72781284-72781306 AGCAGGAGAATTCTACAAAGGGG - Intronic
1192634805 X:72806813-72806835 AGCAGGAGAATTCTGAAAGGGGG - Intronic
1192646910 X:72913988-72914010 AGCAGGAGAATTCTGAAAGGGGG + Intronic
1192650204 X:72939517-72939539 AGCAGGAGAATTCTACAAAGGGG + Intronic
1193223332 X:78953071-78953093 AACAGGATAATTGAGCCATTTGG + Intronic
1194273640 X:91852653-91852675 AGCTAGATAATTCTTCCTTGTGG + Intronic
1200204449 X:154305684-154305706 AGCAGCATAACCCTGCCATGGGG - Intronic
1200590881 Y:5074076-5074098 AGCTAGATAATTCTTCCTTGTGG + Intronic