ID: 1054710384

View in Genome Browser
Species Human (GRCh38)
Location 9:68505082-68505104
Sequence TTATCCTGCTTTGCTTTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054710383_1054710384 -10 Left 1054710383 9:68505069-68505091 CCTCATGGCAGAATTATCCTGCT 0: 1
1: 0
2: 0
3: 19
4: 140
Right 1054710384 9:68505082-68505104 TTATCCTGCTTTGCTTTTGCAGG No data
1054710379_1054710384 17 Left 1054710379 9:68505042-68505064 CCTTTATCTTATTCATCGTTCCA 0: 1
1: 0
2: 1
3: 12
4: 184
Right 1054710384 9:68505082-68505104 TTATCCTGCTTTGCTTTTGCAGG No data
1054710382_1054710384 -3 Left 1054710382 9:68505062-68505084 CCAGTGGCCTCATGGCAGAATTA 0: 1
1: 0
2: 1
3: 12
4: 141
Right 1054710384 9:68505082-68505104 TTATCCTGCTTTGCTTTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054710384 Original CRISPR TTATCCTGCTTTGCTTTTGC AGG Intronic
No off target data available for this crispr