ID: 1054712428

View in Genome Browser
Species Human (GRCh38)
Location 9:68524676-68524698
Sequence GATGAGTCCCACATCAGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054712428_1054712431 -10 Left 1054712428 9:68524676-68524698 CCTCATCTGATGTGGGACTCATC 0: 1
1: 0
2: 0
3: 12
4: 102
Right 1054712431 9:68524689-68524711 GGGACTCATCTGGTCCAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054712428 Original CRISPR GATGAGTCCCACATCAGATG AGG (reversed) Intronic
902296355 1:15469863-15469885 GGTGACTCCCACAGCAGCTGGGG - Intronic
902299149 1:15489135-15489157 GGTGACTCCCACAGCAGCTGGGG - Intronic
902745871 1:18473944-18473966 GGTGAGCCACACATCAGCTGGGG + Intergenic
903499805 1:23794757-23794779 GCTGAGTCCCCCATGAGCTGGGG - Exonic
904039186 1:27574657-27574679 GAAGGGTCCACCATCAGATGGGG + Intronic
907944951 1:59127453-59127475 GATGAGTGCAATACCAGATGGGG + Intergenic
908067892 1:60427258-60427280 GATAAGTTCCACATTAGATATGG - Intergenic
909043853 1:70686122-70686144 GATCAGTCTCACATAGGATGAGG + Intergenic
909574206 1:77155522-77155544 GATAAGTCCCACTTCAGAAAAGG + Intronic
909965466 1:81904507-81904529 CATGAGGCCCTCACCAGATGTGG - Intronic
913252776 1:116925710-116925732 GATGAGTCCCCAATAAGATGAGG - Intronic
922712684 1:227845305-227845327 GATGAGTCCCACCACACATAGGG - Intronic
1063209789 10:3869646-3869668 GGTGAGTCCAAAATCTGATGGGG + Intergenic
1063532634 10:6849508-6849530 GATGAGTCTAACAAAAGATGTGG + Intergenic
1065588899 10:27246150-27246172 GATGAGATCCCCATCTGATGAGG - Intergenic
1065857952 10:29845628-29845650 GGTGAGTCCAACATCTGATGCGG + Intergenic
1067901081 10:50242253-50242275 GATGCTTCCCACATGTGATGAGG + Intronic
1069782932 10:70968192-70968214 GATGAGACCCACAACTCATGGGG - Intergenic
1070260671 10:74851960-74851982 GAAAAGTCCCAGAACAGATGAGG - Intronic
1072985554 10:100136669-100136691 CAAGAGGCCCTCATCAGATGTGG + Intergenic
1075976897 10:126703927-126703949 GATGAGTCCCACTTCACAGCTGG + Intergenic
1076240258 10:128899775-128899797 GATGAGTCCAGAAGCAGATGGGG - Intergenic
1079022695 11:16922893-16922915 GGTGAGTCCAACATCAGTGGAGG - Intronic
1079100223 11:17536704-17536726 GCTGAGTCCCACTTGGGATGTGG - Intronic
1083183340 11:61002757-61002779 GAGAAGGCCCTCATCAGATGTGG - Intronic
1089784568 11:120898812-120898834 GATGAGTTCCAGAGCAGGTGGGG + Intronic
1092758010 12:11783115-11783137 GGTGAGTGGCAGATCAGATGAGG + Intronic
1092901059 12:13059703-13059725 TCTGAGGCCCACATGAGATGTGG + Intronic
1104740026 12:131165322-131165344 CATGAGTCCCCCAGCAGGTGGGG + Intergenic
1105255816 13:18743565-18743587 AGGGAGTCCCACTTCAGATGTGG - Intergenic
1109144081 13:58755724-58755746 GATTAGTCCTTTATCAGATGAGG + Intergenic
1110384286 13:74890711-74890733 GGTGAGTCCAAAATCTGATGGGG - Intergenic
1118306510 14:64659507-64659529 GATGAGGCCCACATCTGGTGGGG - Intergenic
1120126441 14:80749328-80749350 GATTAGTGCCACAACAAATGTGG - Intronic
1120459462 14:84776051-84776073 GAAGAATCCTACATCAGATTTGG + Intergenic
1121150263 14:91626679-91626701 CATGAGGCCCTCACCAGATGTGG + Intronic
1121743367 14:96269213-96269235 GATGAGTCACAAATTTGATGAGG + Intergenic
1128847040 15:70908144-70908166 TATGACTCTCACATCAGATTCGG - Intronic
1129552788 15:76471848-76471870 GATGAGTGCCTGAGCAGATGAGG + Intronic
1133708091 16:8374839-8374861 GATGAGTCCCACAGCTGGTAAGG + Intergenic
1133848578 16:9480239-9480261 GATCAGTCCCACGACACATGGGG - Intergenic
1134063152 16:11211064-11211086 GATCAGCCCCACATCAGTTCTGG - Intergenic
1140915111 16:79486159-79486181 GATGAGCCCCACATGAAAAGAGG - Intergenic
1143510498 17:7393070-7393092 GATGAGGTCCACCTGAGATGAGG - Intronic
1144237839 17:13279258-13279280 CATGAGTCTCAGATCAGCTGGGG + Intergenic
1147767848 17:42849042-42849064 GATGAGTTCCACACCAGGTAAGG - Intronic
1151170287 17:72239873-72239895 GGTGAGTCCAAAATCTGATGGGG - Intergenic
1158196065 18:54886166-54886188 GATGAGTACTATTTCAGATGGGG - Intronic
1160739267 19:678414-678436 GATGCCTCCCACATCAGACTAGG + Intronic
1161624134 19:5316125-5316147 CAGGAGTTCCACATCAGGTGGGG - Intronic
1162023444 19:7879394-7879416 GCTGAGTCCCCCATGAGCTGGGG + Intergenic
1165708540 19:37993213-37993235 GATGACACCCACTTCACATGGGG + Intronic
926053098 2:9757212-9757234 CAGCAGTCCCACATCAGCTGAGG - Intergenic
929244592 2:39687444-39687466 CATGAGCCCCACATCAGGGGTGG - Intronic
930648375 2:53937190-53937212 GATGACACCCAAATAAGATGAGG - Intronic
931153916 2:59606364-59606386 CAGGAGTCCCAGATCAGATTGGG - Intergenic
932596658 2:73097830-73097852 GATGCGTCCCACATCTGGTTGGG - Intronic
935367401 2:102308868-102308890 GATAAGTTCCACAGCGGATGTGG + Intergenic
935587530 2:104815445-104815467 AATGAGTCTCACATCATAAGCGG + Intergenic
937776272 2:125780202-125780224 AATGAGTTCCCCATCAGCTGAGG + Intergenic
940612821 2:156011641-156011663 GAAAAGTCCCACAACAGATGGGG + Intergenic
942657439 2:178229024-178229046 CACGAGGCCCTCATCAGATGTGG - Intronic
944314301 2:198268884-198268906 GGTGAGTCCAAAATCTGATGGGG - Intronic
946331312 2:219010613-219010635 GCTGTGTCCCCCATCATATGGGG + Exonic
947294842 2:228618828-228618850 GGTGAGTCCAAAATCTGATGGGG - Intergenic
948871150 2:240798902-240798924 GGTGAGTCCCACATCACCAGAGG + Intronic
1170990594 20:21298569-21298591 GATGAGTCCAAAATCTGATGGGG + Intergenic
1171060834 20:21957469-21957491 GCTGAGTCCCACACAAGCTGTGG - Intergenic
1175746279 20:61459513-61459535 GAGGATTCCCACAGCAGCTGAGG + Intronic
1178890596 21:36517995-36518017 AGTGAGTCCCAAATCTGATGGGG - Intronic
1179023471 21:37659675-37659697 GGCAAGTCCCACATCAGATGGGG - Intronic
1183222234 22:36522878-36522900 CATGAGGCCCTCACCAGATGTGG + Intronic
1183592279 22:38786756-38786778 GAAGAGCCTCACATCAGAGGGGG - Intronic
949771084 3:7578841-7578863 GATGATTGCCAAACCAGATGTGG + Exonic
951461061 3:22952522-22952544 CCTGAGGCCCACAGCAGATGTGG - Intergenic
951911502 3:27755117-27755139 GATGAGCCCCACAGTAGAGGTGG + Intergenic
955904967 3:63797313-63797335 GATGAGTCCCAGATAATATAAGG + Intergenic
968842085 4:3014945-3014967 GAGGAGGCCCACATGAGAAGGGG - Intronic
969246008 4:5933448-5933470 GGTCAGCCCCACAGCAGATGGGG - Intronic
969533744 4:7743156-7743178 GCACAGTCCCACATCTGATGGGG + Intergenic
970052428 4:11929722-11929744 GGTGAGTCCCACCTCATCTGAGG + Intergenic
971333819 4:25704473-25704495 GCTGAGGCCCTCACCAGATGTGG - Intergenic
979789188 4:124756680-124756702 GACAAGTCCCAAATCTGATGTGG - Intergenic
981531253 4:145755759-145755781 GAAGAGTCCCACACAAAATGGGG - Intronic
982566385 4:156992307-156992329 CATGAGTCCCATTTCGGATGAGG + Intergenic
994801409 5:104381522-104381544 GGTGCGTCCCACAACACATGGGG + Intergenic
994804469 5:104426389-104426411 GGTGAGTCCAAAATCTGATGGGG - Intergenic
997695138 5:135855727-135855749 TATGAGTCCCAGCTCAGCTGGGG - Intronic
1002522359 5:179798809-179798831 TACGAGGCCCACTTCAGATGCGG + Intronic
1003811595 6:9788948-9788970 GGTGAGTCCCACAGCAACTGTGG + Intronic
1005750374 6:28876361-28876383 GATGAATCCCCCACCAGATTAGG - Intergenic
1006327555 6:33365501-33365523 GCTGAGTCCCCCATGAGCTGGGG + Intergenic
1007707281 6:43798607-43798629 TGTGAGTCCCAGATCAGAGGAGG + Intergenic
1007838821 6:44698760-44698782 GATGAGCCACACTTCAGAGGAGG - Intergenic
1008459701 6:51753745-51753767 GAGGAGTCCCACATCAACTGAGG + Intronic
1015225329 6:130851008-130851030 GATTAATCACACCTCAGATGAGG - Intronic
1015480042 6:133698789-133698811 GAGGGGTCCCACATCTGATGCGG - Intergenic
1024575872 7:50763811-50763833 GCTGAGTCCCAGTTCAGATGAGG - Intronic
1026215113 7:68341721-68341743 AAAGAGTCCCACATCGGCTGGGG + Intergenic
1028484097 7:91339602-91339624 TATGAGTCCCACATCACCTGGGG - Intergenic
1029216896 7:98957056-98957078 CATGGGTGCCACATAAGATGGGG - Intronic
1030187367 7:106777221-106777243 GATCCGTCCCACAACACATGGGG + Intergenic
1038071791 8:24024667-24024689 GATAAATCTCACATCAGTTGTGG - Intergenic
1039888814 8:41670948-41670970 GATGAGACAGACATGAGATGGGG - Intronic
1051152194 9:14094435-14094457 GTTGAGTTCCACTTCAGATGAGG + Intronic
1052786720 9:32835100-32835122 AATAAGACCCTCATCAGATGTGG + Intergenic
1054712428 9:68524676-68524698 GATGAGTCCCACATCAGATGAGG - Intronic
1055868481 9:80845026-80845048 AATAAGTCCCACGCCAGATGCGG + Intergenic
1056548239 9:87630583-87630605 GATGTGTGCCATTTCAGATGCGG - Intronic
1060236310 9:121865518-121865540 AATGTGTCCCACATCAGAATTGG - Intronic
1061130720 9:128706339-128706361 GATGCTTCCCCCATCAGATCAGG - Intronic
1185791417 X:2930275-2930297 GATGAGTCACAGAAAAGATGGGG - Intergenic
1189400889 X:40667559-40667581 GGTGGGTCCCAGATCACATGGGG + Intronic
1194397302 X:93402085-93402107 GATGAGTCCCATATGAGATTAGG + Intergenic
1196578112 X:117345256-117345278 AATGATTCTCACATGAGATGAGG - Intergenic