ID: 1054712428

View in Genome Browser
Species Human (GRCh38)
Location 9:68524676-68524698
Sequence GATGAGTCCCACATCAGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054712428_1054712431 -10 Left 1054712428 9:68524676-68524698 CCTCATCTGATGTGGGACTCATC No data
Right 1054712431 9:68524689-68524711 GGGACTCATCTGGTCCAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054712428 Original CRISPR GATGAGTCCCACATCAGATG AGG (reversed) Intronic