ID: 1054721447

View in Genome Browser
Species Human (GRCh38)
Location 9:68608130-68608152
Sequence TGGTGAACCCTGCAATTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054721444_1054721447 -5 Left 1054721444 9:68608112-68608134 CCATCAGGCAACCAAGGATGGTG No data
Right 1054721447 9:68608130-68608152 TGGTGAACCCTGCAATTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054721447 Original CRISPR TGGTGAACCCTGCAATTTGG AGG Intergenic
No off target data available for this crispr