ID: 1054726920

View in Genome Browser
Species Human (GRCh38)
Location 9:68661887-68661909
Sequence ATGTGATGCTAGCAGTATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054726917_1054726920 18 Left 1054726917 9:68661846-68661868 CCACCACATTACCAACAAAAAAT No data
Right 1054726920 9:68661887-68661909 ATGTGATGCTAGCAGTATGTAGG No data
1054726919_1054726920 7 Left 1054726919 9:68661857-68661879 CCAACAAAAAATGTCACTAGCTG No data
Right 1054726920 9:68661887-68661909 ATGTGATGCTAGCAGTATGTAGG No data
1054726918_1054726920 15 Left 1054726918 9:68661849-68661871 CCACATTACCAACAAAAAATGTC No data
Right 1054726920 9:68661887-68661909 ATGTGATGCTAGCAGTATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054726920 Original CRISPR ATGTGATGCTAGCAGTATGT AGG Intergenic
No off target data available for this crispr