ID: 1054729877

View in Genome Browser
Species Human (GRCh38)
Location 9:68690555-68690577
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054729876_1054729877 -7 Left 1054729876 9:68690539-68690561 CCAACGTAAGTCTTTTTGCAAAA No data
Right 1054729877 9:68690555-68690577 TGCAAAAATTAAACTCTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054729877 Original CRISPR TGCAAAAATTAAACTCTTTT AGG Intergenic
No off target data available for this crispr