ID: 1054729878

View in Genome Browser
Species Human (GRCh38)
Location 9:68690590-68690612
Sequence ACATGCTATTTGTAAAAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054729876_1054729878 28 Left 1054729876 9:68690539-68690561 CCAACGTAAGTCTTTTTGCAAAA No data
Right 1054729878 9:68690590-68690612 ACATGCTATTTGTAAAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054729878 Original CRISPR ACATGCTATTTGTAAAAATT TGG Intergenic
No off target data available for this crispr