ID: 1054734380

View in Genome Browser
Species Human (GRCh38)
Location 9:68735737-68735759
Sequence GTAAAGCAGGATAAGGGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054734374_1054734380 26 Left 1054734374 9:68735688-68735710 CCACAAATAGATATTTTAAATAT 0: 1
1: 0
2: 12
3: 146
4: 1438
Right 1054734380 9:68735737-68735759 GTAAAGCAGGATAAGGGAGTAGG No data
1054734373_1054734380 30 Left 1054734373 9:68735684-68735706 CCGGCCACAAATAGATATTTTAA 0: 1
1: 2
2: 23
3: 148
4: 912
Right 1054734380 9:68735737-68735759 GTAAAGCAGGATAAGGGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054734380 Original CRISPR GTAAAGCAGGATAAGGGAGT AGG Intronic
No off target data available for this crispr