ID: 1054736822

View in Genome Browser
Species Human (GRCh38)
Location 9:68761575-68761597
Sequence CCTTCCTTTTGGAGGCTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054736815_1054736822 23 Left 1054736815 9:68761529-68761551 CCAAAATTGGTCTCACTGGACTA 0: 1
1: 8
2: 54
3: 182
4: 428
Right 1054736822 9:68761575-68761597 CCTTCCTTTTGGAGGCTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054736822 Original CRISPR CCTTCCTTTTGGAGGCTCTG GGG Intronic
No off target data available for this crispr