ID: 1054737512

View in Genome Browser
Species Human (GRCh38)
Location 9:68770373-68770395
Sequence GAGGACTGGTGGCAAAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 207}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054737512_1054737524 9 Left 1054737512 9:68770373-68770395 CCTGCCTTTTGCCACCAGTCCTC 0: 1
1: 0
2: 1
3: 25
4: 207
Right 1054737524 9:68770405-68770427 GCTGGGGGTCTGACTTCTCAGGG No data
1054737512_1054737526 27 Left 1054737512 9:68770373-68770395 CCTGCCTTTTGCCACCAGTCCTC 0: 1
1: 0
2: 1
3: 25
4: 207
Right 1054737526 9:68770423-68770445 CAGGGTAAAAATAAGGATGAAGG No data
1054737512_1054737516 -9 Left 1054737512 9:68770373-68770395 CCTGCCTTTTGCCACCAGTCCTC 0: 1
1: 0
2: 1
3: 25
4: 207
Right 1054737516 9:68770387-68770409 CCAGTCCTCCTGCACCTTGCTGG No data
1054737512_1054737518 -7 Left 1054737512 9:68770373-68770395 CCTGCCTTTTGCCACCAGTCCTC 0: 1
1: 0
2: 1
3: 25
4: 207
Right 1054737518 9:68770389-68770411 AGTCCTCCTGCACCTTGCTGGGG No data
1054737512_1054737523 8 Left 1054737512 9:68770373-68770395 CCTGCCTTTTGCCACCAGTCCTC 0: 1
1: 0
2: 1
3: 25
4: 207
Right 1054737523 9:68770404-68770426 TGCTGGGGGTCTGACTTCTCAGG No data
1054737512_1054737519 -6 Left 1054737512 9:68770373-68770395 CCTGCCTTTTGCCACCAGTCCTC 0: 1
1: 0
2: 1
3: 25
4: 207
Right 1054737519 9:68770390-68770412 GTCCTCCTGCACCTTGCTGGGGG No data
1054737512_1054737517 -8 Left 1054737512 9:68770373-68770395 CCTGCCTTTTGCCACCAGTCCTC 0: 1
1: 0
2: 1
3: 25
4: 207
Right 1054737517 9:68770388-68770410 CAGTCCTCCTGCACCTTGCTGGG No data
1054737512_1054737525 20 Left 1054737512 9:68770373-68770395 CCTGCCTTTTGCCACCAGTCCTC 0: 1
1: 0
2: 1
3: 25
4: 207
Right 1054737525 9:68770416-68770438 GACTTCTCAGGGTAAAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054737512 Original CRISPR GAGGACTGGTGGCAAAAGGC AGG (reversed) Intronic
900788088 1:4662259-4662281 GAGGAGTGGTCGTCAAAGGCTGG - Intronic
901123155 1:6911215-6911237 GGGAGCTGGTGGCAAATGGCAGG + Intronic
901261770 1:7876396-7876418 CAGCATTGGTGGCAACAGGCTGG - Intergenic
901438335 1:9262983-9263005 AAGGCCTGGTGGCAAGAGCCAGG - Intronic
902687203 1:18086049-18086071 GAGGACTGGGGCCAGGAGGCTGG - Intergenic
904078767 1:27858831-27858853 GAGGACTGCTGCCAACAGGATGG - Intergenic
904629151 1:31828544-31828566 GAAGCCTGGTGGCCAAAGGAAGG + Intergenic
904951629 1:34245827-34245849 GGGGACTGGTGGTGAAAGTCTGG - Intergenic
906067878 1:42995179-42995201 GGGGCCGGATGGCAAAAGGCTGG + Intergenic
906707534 1:47905728-47905750 GAGGGCTGGGGACAAAAGGGAGG - Intronic
907185192 1:52603551-52603573 GGGGACTGGTGTGAAATGGCTGG + Intronic
914258402 1:145978863-145978885 GAGGCCTGGTGACAGAGGGCTGG + Intergenic
914354869 1:146875875-146875897 GAGGGATGGTGCCAAGAGGCTGG - Intergenic
915109254 1:153552705-153552727 GAGGGCAGGTGGCAAGAGGAAGG - Intergenic
915289389 1:154872830-154872852 AAGAACTGGAGGCAAGAGGCTGG - Intergenic
916127635 1:161585455-161585477 GAGGACTGGAGGCAGAGGGTGGG + Intronic
916137553 1:161667259-161667281 GAGGACTGGAGGCAGAGGGTGGG + Intronic
917615846 1:176743437-176743459 GAGCACTGGTGGCCAAAATCAGG - Intronic
920437457 1:205956691-205956713 AAGGACTGGAGGGAACAGGCTGG - Intergenic
920699990 1:208210542-208210564 GAGGCCTGGTGTCCTAAGGCTGG - Intronic
921257455 1:213355285-213355307 GGGGGCTGGTGGAAGAAGGCTGG + Intergenic
921633161 1:217458742-217458764 GAGGACTGAAGGAAAAAAGCAGG - Intronic
923359545 1:233197086-233197108 GATGAATGGTGGCCAGAGGCTGG + Intronic
1063141278 10:3258519-3258541 GAGGGCTGCTGGAAAAATGCAGG + Intergenic
1064132175 10:12719846-12719868 GAGGACTGGAATCTAAAGGCTGG - Intronic
1065619407 10:27565038-27565060 GAAGACTGGTTGCCAGAGGCTGG - Intergenic
1065914820 10:30345430-30345452 GTGGACTGCTGGCAAAGAGCAGG + Intronic
1066044045 10:31580821-31580843 GAGGGCTGGAGGCCAAGGGCAGG + Intergenic
1067844509 10:49709234-49709256 TAGGGCTTGTGGCAAAAGGATGG + Exonic
1068551013 10:58408102-58408124 GAGGCCCTGTGGCAAAAGGAAGG - Intergenic
1072691427 10:97574598-97574620 AAGGACTTGTTGGAAAAGGCTGG + Intronic
1074164110 10:110859604-110859626 GACTCCTGCTGGCAAAAGGCTGG - Intergenic
1074971822 10:118545330-118545352 GAGGACTGGGGACACAAGGTGGG - Intergenic
1076736600 10:132461890-132461912 CAGGGCAGGTGGCAAAGGGCAGG - Intergenic
1077159674 11:1107038-1107060 GAGGACAGGTGGCACCAGGCAGG - Intergenic
1077962075 11:7086377-7086399 TAGGGCTTGTGGCAAAAGCCTGG - Intergenic
1078487615 11:11738581-11738603 GATGACTACTGGCACAAGGCTGG - Intergenic
1082774552 11:57235419-57235441 GGGGATTGGTGCCAGAAGGCAGG + Exonic
1083282624 11:61636603-61636625 GAGGATGCCTGGCAAAAGGCAGG - Intergenic
1089118240 11:116113368-116113390 GAGGAGTGGAGGTCAAAGGCTGG - Intergenic
1089294436 11:117459342-117459364 GAGGTCTGGCGGCCCAAGGCGGG - Intronic
1089312205 11:117565990-117566012 GAGGACTGGTAGCCTAAGCCAGG + Intronic
1089397314 11:118144927-118144949 GAGAAAGGGTGGCAAAAGGTGGG + Intronic
1089788024 11:120921969-120921991 GAGGTGTGGTGGCAGCAGGCTGG + Intronic
1091451644 12:575881-575903 CAGGACTGCTGAGAAAAGGCAGG - Intronic
1092157899 12:6296261-6296283 GGTGACTCGTGTCAAAAGGCTGG - Intergenic
1092777319 12:11955114-11955136 GAAGAGAGGTGGCAAAAAGCAGG + Intergenic
1095316892 12:40774240-40774262 GAGGATTGGTGACAAAAGGAAGG + Intronic
1095334139 12:41006464-41006486 GGGTACTGGTGGGAAAAGTCTGG + Intronic
1096439545 12:51628667-51628689 GAGTATTGGTGTCAACAGGCTGG + Intronic
1096739855 12:53685172-53685194 GAGGACTGATGAGAAAGGGCAGG + Intergenic
1097344707 12:58477951-58477973 GAGGAGTGATGGCCTAAGGCAGG - Intergenic
1101375572 12:104168452-104168474 GATCACTGGTGCAAAAAGGCTGG + Intergenic
1104121626 12:125805422-125805444 GAGGGATGGTGGCACAGGGCAGG + Intergenic
1104993631 12:132640880-132640902 GAGGACTGGTGGAAAGAGGCAGG - Intronic
1105994252 13:25654982-25655004 GTGGACAGGTGGAAAAAGACTGG + Intronic
1108508390 13:51133907-51133929 GAGGACAGGGGACAAAAGCCAGG + Intergenic
1108718966 13:53110538-53110560 AGGGACTGGTGGCAGGAGGCTGG + Intergenic
1110339289 13:74370242-74370264 GAGTTCTGGTGTCAAAGGGCAGG - Intergenic
1111918109 13:94382791-94382813 GAGGAATGGTGGCAGATGCCAGG + Intronic
1113240778 13:108334796-108334818 GAGGACTTGAGGGAAAAGGTGGG + Intergenic
1114787902 14:25622081-25622103 AAGGTCTGGGGGCAAAAAGCTGG + Intergenic
1117502559 14:56367945-56367967 CAGGAGTGGTGGGAAAAGGTAGG - Intergenic
1118864479 14:69692177-69692199 GAGAAGTGGAGGGAAAAGGCAGG - Intronic
1119144540 14:72299285-72299307 GAGGAGTGGTAGCCTAAGGCTGG - Intronic
1119732069 14:76957245-76957267 GGGGACTGGTGGCAGAGGGTGGG - Intergenic
1121127634 14:91418026-91418048 GGGGACTGGTGGCCCGAGGCGGG + Intergenic
1121837031 14:97101408-97101430 AAGGGCTGGGGGGAAAAGGCTGG + Intergenic
1121886697 14:97549594-97549616 GAGGCCTGGTGGTTAAAGTCTGG - Intergenic
1124100034 15:26684310-26684332 GAGGTCTGGTGGCCACAGGCAGG + Intronic
1124229280 15:27928694-27928716 GAGGAATGGAGGCATGAGGCTGG - Intronic
1128127923 15:65206693-65206715 GAGTTCTGGTGGCCAGAGGCAGG + Intronic
1129122152 15:73405522-73405544 GAAGAATGGTGGCCAGAGGCTGG - Intergenic
1131714867 15:95097509-95097531 GTGGAGTAGTGGAAAAAGGCTGG + Intergenic
1132598760 16:764754-764776 GAGGGCTGGCGGCAAAAGCCGGG - Intronic
1133038833 16:3049201-3049223 GAGGGATGGTGGCAGAAGGATGG + Intronic
1133285940 16:4690813-4690835 CAGGACTGATGGCCAGAGGCTGG - Exonic
1133864199 16:9626605-9626627 GTGGACTGGAGACAAAAGGCAGG + Intergenic
1134073452 16:11274809-11274831 GAGGACTGGGGGGATAAGACTGG - Intronic
1134768395 16:16782636-16782658 GAGCTCTGGTGGCAAAAGAACGG + Intergenic
1136277821 16:29189441-29189463 GAGGACTGGTTGCCAGAGGCTGG - Intergenic
1138241810 16:55433613-55433635 GGGGAGTGTTGGCAAAAGGATGG - Intronic
1138407353 16:56807188-56807210 GAGGACTGGAGGCAGAAGCAGGG - Intronic
1138529984 16:57629727-57629749 GAGGTCTGGTGGCAACGGGCAGG - Intronic
1140117501 16:72055544-72055566 GAGAACTGGTGTCCAAAAGCAGG - Intronic
1140148217 16:72333075-72333097 CAGTAGTGGTGGCAGAAGGCAGG + Intergenic
1140988447 16:80183575-80183597 TGGGACTGGGGGCAAAAGGGGGG + Intergenic
1141514520 16:84534969-84534991 GAGGAATGGGGGGAAAAGGAGGG - Intronic
1141520640 16:84576655-84576677 GATGACTGGTGGGGAAAGGCTGG - Intronic
1141992505 16:87618570-87618592 GTGGCCAGGTGGAAAAAGGCTGG - Intronic
1142082195 16:88155481-88155503 GAGGACTGGTTGCCAGAGGCTGG - Intergenic
1142765444 17:2061655-2061677 GAGGACAGGAGGCAGAGGGCTGG + Intronic
1146075615 17:29725748-29725770 GAGGGCTGGGGGCAAGAGGAGGG + Intronic
1147156855 17:38548399-38548421 AAGAAATGGAGGCAAAAGGCTGG + Intronic
1148219417 17:45851320-45851342 AAGGCCTGGTGGGGAAAGGCTGG - Intergenic
1149746666 17:59106099-59106121 AAGGACTGGTGGCGAGTGGCAGG + Intronic
1149813848 17:59704246-59704268 GAAGTCTGGTGGCAAAAGAAAGG + Intronic
1151561457 17:74872115-74872137 GAGAAATGGTGGCAGAAGCCTGG + Exonic
1152190807 17:78886100-78886122 CAGGACAGGTGGGAAAGGGCCGG + Intronic
1152484811 17:80583612-80583634 GAAGACTGAAGGCAAGAGGCGGG - Intronic
1153526352 18:5998383-5998405 GAGGCCTGGTGGAAGAAGCCTGG + Intronic
1155809359 18:30212108-30212130 GAGATCTGGTGGGAAAAGGCAGG + Intergenic
1156105501 18:33654797-33654819 GAGGTTAGGTGGCTAAAGGCTGG + Intronic
1156475582 18:37403471-37403493 GAGGGCTGGGGACAAATGGCTGG + Intronic
1156528225 18:37788978-37789000 GAAGACAGGTAGCAAAAGACAGG + Intergenic
1158591424 18:58782117-58782139 GAGGGATGGTGGCAAGAGGAGGG - Intergenic
1158711241 18:59839949-59839971 GAGGTCTGGTTGCAGAAGGGAGG + Intergenic
1159537110 18:69728129-69728151 GAGGACTGGAGTCAAAGAGCAGG - Intronic
1161286489 19:3471126-3471148 GAGGGCTGGGGGCAGAAGGATGG + Intergenic
1161810136 19:6466772-6466794 GAGGACTTGTGGGGAGAGGCTGG + Intronic
1166192504 19:41184330-41184352 AAGGAGTGGTGGAAAAAGTCAGG + Intergenic
1166776877 19:45318437-45318459 GAGGACTGGTGGGAACTGGGAGG + Intronic
1168720244 19:58550792-58550814 AAGCACTGGTGGCACAAGGGAGG + Intergenic
925524642 2:4786543-4786565 TAGGACAAGTGGCAGAAGGCAGG - Intergenic
925624656 2:5830760-5830782 GGGAAATGGAGGCAAAAGGCAGG - Intergenic
925996150 2:9294946-9294968 GGGGGCTGGTGGCCACAGGCAGG - Intronic
927946716 2:27139121-27139143 GAGGACTGAGGGCAAAACTCAGG - Intronic
927990800 2:27445552-27445574 GAGGATTCGTGGCTAAAAGCTGG - Intronic
928414395 2:31079584-31079606 GAGGTCTGGTGGCAGCAGGCTGG - Intronic
933226036 2:79750688-79750710 GAAGTCTGGTGGCAGCAGGCTGG + Intronic
936235477 2:110739183-110739205 GAAGGCTGGTTGCAAATGGCGGG + Intronic
937323974 2:120978115-120978137 GAGGACTGATTGGAAAATGCAGG + Intronic
937333785 2:121048111-121048133 GAAAACTGATGGCAAGAGGCAGG - Intergenic
938066463 2:128284335-128284357 GGGGACAGGTGGCAACAGGTGGG - Intronic
940630890 2:156237053-156237075 GAGTAGTGGTGGCTAGAGGCTGG + Intergenic
942206210 2:173622060-173622082 GAGGCCAGGTTGGAAAAGGCAGG + Intergenic
942671034 2:178376708-178376730 GAAGACAGGTGGCATGAGGCTGG - Intronic
944664648 2:201949780-201949802 GCGGCCTGGAGGCAAAGGGCCGG + Intergenic
945159447 2:206874234-206874256 GAGGACAGGTGGTAAAATGCAGG - Intergenic
946971703 2:225100614-225100636 GTGTACTGGTGGGAGAAGGCAGG - Intergenic
947088013 2:226477446-226477468 GAGGACTGCTGGAAGAAGGCAGG - Intergenic
947527401 2:230886933-230886955 GAGGACTGATGGGAAAGGGAAGG + Intergenic
948699815 2:239752530-239752552 GAGGCCTGGTGGCAGCAGGCCGG + Intergenic
1168868070 20:1105909-1105931 ATGGCCTGGTGGAAAAAGGCTGG - Intergenic
1170509016 20:17057979-17058001 GAGGAGTGGTGGAATAAGGGAGG + Intergenic
1172020261 20:31908886-31908908 GAGGACTGGAGGTCACAGGCTGG + Intronic
1173775780 20:45704988-45705010 GAACACTGGTGGCCAAAGGATGG - Exonic
1175161368 20:57010092-57010114 GAAGGCTGGAGGCACAAGGCTGG - Intergenic
1179564308 21:42237026-42237048 GAGGCCTAGAGGCACAAGGCTGG - Intronic
1182017313 22:27051650-27051672 GAGGAATGGTGGAAAATGGAAGG + Intergenic
1183346865 22:37312884-37312906 GAGGCCTGGTGGCCAGAGGAAGG + Intronic
1183618000 22:38956685-38956707 GAGGATTGCTGGCCAAAGACAGG + Intronic
1183751489 22:39723587-39723609 GAGGGCAGGAGGCAGAAGGCGGG - Intergenic
1184164135 22:42717489-42717511 GAGGACAGGAGGCAAGAGGGAGG - Intronic
1184375454 22:44109212-44109234 GAGGGCTGATTGCAACAGGCAGG - Intronic
1184686286 22:46097868-46097890 GAGGTCTGGTGGCTGAAGACTGG - Intronic
1184759895 22:46538007-46538029 GAGGACTGGGGCCGAGAGGCCGG + Intergenic
955173504 3:56588290-56588312 GAGGACTTATGGAGAAAGGCTGG + Intronic
955997147 3:64688573-64688595 GGGGACTGGTGGCAAGAGATGGG - Intergenic
960316576 3:116185855-116185877 GAGGAGTTGGGGTAAAAGGCGGG + Intronic
960634913 3:119775184-119775206 GAGGTCTGGGAGCAAAAGCCAGG + Intergenic
962264887 3:133937829-133937851 GAGGGCTGGGGGCACAATGCAGG - Intronic
962875578 3:139533798-139533820 GAGGGCTGGGAGCAGAAGGCAGG + Intronic
965430588 3:168582863-168582885 GAGCTCTGGTGTCCAAAGGCAGG - Intergenic
968519396 4:1028840-1028862 GAGGACTTGAGGCAGGAGGCGGG + Intergenic
969094027 4:4718766-4718788 GAGGACAAGAGGCAAAAGCCTGG + Intergenic
970486452 4:16529475-16529497 GAGAAGTGGTGGCAGAAGGCAGG - Intronic
970654221 4:18213421-18213443 GTGCACTGGTGGCAATAGGGTGG + Intergenic
974149029 4:57981804-57981826 GAAGAAAGCTGGCAAAAGGCAGG + Intergenic
976896020 4:90112903-90112925 GAGCACTGGGAGGAAAAGGCAGG + Intergenic
981538032 4:145820757-145820779 GAGGATTGGGGGCAAATGACAGG - Intronic
983940624 4:173531407-173531429 GAGGGCGGGTGGTAAATGGCAGG + Intergenic
984851727 4:184159805-184159827 GGGGACTCATGGCAAAAGGGTGG - Intronic
984891745 4:184500082-184500104 GAGCACTGATGGCTAAGGGCAGG + Intergenic
986279252 5:6310058-6310080 GAGGACTGGAGGAGAAAGACTGG + Intergenic
987281213 5:16415435-16415457 GAGGATTGGAGGCACAAAGCGGG - Intergenic
987786236 5:22502612-22502634 GATGACTGCTGGCAATAGACTGG - Intronic
988150214 5:27367870-27367892 GACTCCTGGTGCCAAAAGGCTGG - Intergenic
988567301 5:32329668-32329690 GAGGCCTGGTGACAGAGGGCAGG - Intergenic
990665651 5:58069123-58069145 GAGGAGTGGGGGCACATGGCGGG - Intergenic
992640653 5:78765967-78765989 GAGGACTAGTTACAAAGGGCAGG - Intronic
993027318 5:82661690-82661712 TAGGGGTGGTTGCAAAAGGCTGG + Intergenic
994612293 5:102058769-102058791 GAGGTATGGTGCCAGAAGGCAGG + Intergenic
995979465 5:118083845-118083867 GAGGAGTGTTCCCAAAAGGCTGG - Intergenic
998820601 5:146054308-146054330 GGGGACTGATGGAATAAGGCTGG + Intronic
1000023807 5:157341633-157341655 CAGGAATGGGGGCAAAAGTCTGG + Exonic
1003503393 6:6721016-6721038 GAAGAATGGTTGCCAAAGGCTGG + Intergenic
1003928728 6:10902298-10902320 GAGAACTGCTGTCAAAATGCAGG - Intronic
1004052964 6:12107433-12107455 GGGTACTGGTGGCTAAAGGTTGG + Intronic
1006645102 6:35510352-35510374 GAGGACATGGGACAAAAGGCAGG - Intronic
1007124203 6:39411244-39411266 GAGGCCTGGAGGCAGAACGCTGG + Intronic
1007322487 6:41037703-41037725 GATGCCTGGTTGAAAAAGGCTGG - Intronic
1008399568 6:51049149-51049171 GAGGATTTGTGGGAAATGGCTGG - Intergenic
1013647529 6:112160220-112160242 GGGGGCTGGTTGCAAAAAGCTGG - Intronic
1014209892 6:118697334-118697356 GAGGACTGGTGACAAGTGTCTGG - Intronic
1015706887 6:136097845-136097867 GAGGACTTGTGGCAGGAGGATGG - Intronic
1018063063 6:160105320-160105342 GAGGACTTGGGGCAAAACCCTGG - Exonic
1018254136 6:161901791-161901813 GAGGTATGATGGCAAAAGGACGG + Intronic
1019132790 6:169889687-169889709 AAGGACTGAGGGCAAACGGCAGG - Intergenic
1020245030 7:6423316-6423338 GAGGACTGGGGCCAAAAGCGGGG + Intronic
1020272062 7:6602837-6602859 GAGGACTTCAGGCAGAAGGCAGG - Intronic
1020374931 7:7474278-7474300 GAGGACTCGGGGCAAAAGGGTGG + Intronic
1020712721 7:11629046-11629068 GAGGACTGCTGGATACAGGCAGG + Intronic
1021868794 7:24983065-24983087 GAGGACTTCTGGCAAAAGTCTGG - Intergenic
1022316178 7:29247467-29247489 GAGGGCTGTGGGCAGAAGGCTGG - Intronic
1023876498 7:44289125-44289147 GGGGACTGGAGGGAAGAGGCAGG - Intronic
1026019340 7:66695549-66695571 GAGGACTGGGGACAAAAGCCAGG + Intronic
1026881051 7:73907040-73907062 GAGGACTGGGGACAAAAGCCAGG - Intergenic
1027226148 7:76244763-76244785 GAGAACTGGAGGCAGAAAGCTGG - Intronic
1029505719 7:100963016-100963038 GAGGACTGATGCCCAGAGGCAGG - Intronic
1030138990 7:106285567-106285589 GAGGGATGGAGGCGAAAGGCTGG - Intronic
1031083476 7:117280137-117280159 CAGGAAGGATGGCAAAAGGCCGG + Intronic
1037853699 8:22354070-22354092 GAAGAATGGTGGTAACAGGCTGG - Intronic
1039091668 8:33836359-33836381 GAGCACTGGTGTCCAAGGGCAGG - Intergenic
1039360701 8:36873659-36873681 GAGGACTGCAAGCACAAGGCAGG + Intronic
1041015701 8:53591320-53591342 GAGGAGTGATGGCCAAAGACAGG - Intergenic
1043506077 8:80904474-80904496 GAGGACTGGTGGGATACGGCAGG - Intergenic
1045636593 8:104198753-104198775 GAGGACTGGACCTAAAAGGCTGG - Intronic
1049526170 8:143127880-143127902 GAGGAATGGCGGCAAATGGCGGG + Intergenic
1050903785 9:10977919-10977941 GAGGCCTGGGGGGAAAAGGTGGG + Intergenic
1051231747 9:14962480-14962502 GAGGACAGGTGGCAAAAATTAGG + Intergenic
1052544156 9:29851800-29851822 GAGGACAGCTAGCAAAATGCTGG + Intergenic
1054737512 9:68770373-68770395 GAGGACTGGTGGCAAAAGGCAGG - Intronic
1055577232 9:77672116-77672138 TAAGGCTGGTGGCAGAAGGCTGG + Intergenic
1056021816 9:82445771-82445793 CAGGATGGGTGGCAAAAAGCAGG - Intergenic
1056400523 9:86223134-86223156 AAGAAGTGGTGGCAAAAGGAAGG + Intronic
1056905519 9:90644433-90644455 GATGGCATGTGGCAAAAGGCAGG - Intergenic
1057083969 9:92191952-92191974 GATGCCTGGAGGGAAAAGGCGGG - Intergenic
1057432718 9:95008698-95008720 GATGACTGGAAGCAGAAGGCGGG - Intronic
1057460908 9:95260941-95260963 GAGGACTGGAAGGAAAAGGAGGG - Intronic
1057954260 9:99395378-99395400 GAGGACTGGGAGGAAGAGGCTGG + Intergenic
1058005287 9:99907156-99907178 GAGGACTGGGAGCGAGAGGCCGG + Intronic
1061455593 9:130695218-130695240 GGGGAATGGTGGCAACAGGGTGG + Intronic
1061806768 9:133141286-133141308 GTAGAATGGTGGGAAAAGGCAGG - Intronic
1062473807 9:136717966-136717988 GGGGGCTGGGGGCAGAAGGCAGG + Intronic
1187151642 X:16686605-16686627 GAGGCCTGGAGGCCAAAGGCTGG + Intronic
1187792327 X:22964457-22964479 GACGAGTGGTGGAATAAGGCAGG + Intergenic
1189004350 X:36980546-36980568 GAGGACAGGTGGGAAAGGGGAGG - Intergenic
1189044569 X:37576750-37576772 GAGGACAGGTGGCAAAGGGGAGG + Intronic
1189239005 X:39511400-39511422 GAGCACTGTTAGCAAAAGGGGGG + Intergenic
1190169634 X:48101667-48101689 GAAGTCTGGTGTCCAAAGGCAGG + Intergenic
1193149326 X:78108273-78108295 AAGGACTAATGGCAAAAGGATGG - Intronic
1196288492 X:113911234-113911256 GAGGACTGCTGGGGAAAGGCAGG + Intergenic
1201946840 Y:19519874-19519896 GAGGACAGGAGGCAAAAGGAAGG + Intergenic