ID: 1054737513

View in Genome Browser
Species Human (GRCh38)
Location 9:68770377-68770399
Sequence GCAGGAGGACTGGTGGCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 324}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054737513_1054737526 23 Left 1054737513 9:68770377-68770399 CCTTTTGCCACCAGTCCTCCTGC 0: 1
1: 0
2: 0
3: 27
4: 324
Right 1054737526 9:68770423-68770445 CAGGGTAAAAATAAGGATGAAGG No data
1054737513_1054737524 5 Left 1054737513 9:68770377-68770399 CCTTTTGCCACCAGTCCTCCTGC 0: 1
1: 0
2: 0
3: 27
4: 324
Right 1054737524 9:68770405-68770427 GCTGGGGGTCTGACTTCTCAGGG No data
1054737513_1054737525 16 Left 1054737513 9:68770377-68770399 CCTTTTGCCACCAGTCCTCCTGC 0: 1
1: 0
2: 0
3: 27
4: 324
Right 1054737525 9:68770416-68770438 GACTTCTCAGGGTAAAAATAAGG No data
1054737513_1054737523 4 Left 1054737513 9:68770377-68770399 CCTTTTGCCACCAGTCCTCCTGC 0: 1
1: 0
2: 0
3: 27
4: 324
Right 1054737523 9:68770404-68770426 TGCTGGGGGTCTGACTTCTCAGG No data
1054737513_1054737519 -10 Left 1054737513 9:68770377-68770399 CCTTTTGCCACCAGTCCTCCTGC 0: 1
1: 0
2: 0
3: 27
4: 324
Right 1054737519 9:68770390-68770412 GTCCTCCTGCACCTTGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054737513 Original CRISPR GCAGGAGGACTGGTGGCAAA AGG (reversed) Intronic
901077951 1:6567169-6567191 GTAAGAGGTCTGGTGGCACATGG + Intronic
902616386 1:17625762-17625784 GCAGGGGCACTGGTGGGAGAGGG + Intronic
902686298 1:18079866-18079888 GCAGGAAGACAAGTGGCACAAGG - Intergenic
903680623 1:25094139-25094161 GCAGGATGAGTGAGGGCAAATGG + Intergenic
905298247 1:36968370-36968392 GCAGGATAACTGGTGGCCATTGG + Intronic
905451618 1:38060581-38060603 GCAGGAGAACTGGTGAGATAAGG + Intergenic
907159799 1:52361608-52361630 GCAGGGGGGCTGGGGGAAAAAGG + Exonic
907306574 1:53516473-53516495 GCAGCAGGGCCTGTGGCAAAGGG + Intronic
907782545 1:57580404-57580426 GCAGGAGGACAGGTGTCAGGTGG - Intronic
910418276 1:87025420-87025442 GCAGGAAGCCAGATGGCAAATGG + Intronic
912980597 1:114368239-114368261 GCAGCAGTGCTAGTGGCAAAGGG - Intergenic
913350366 1:117851470-117851492 GAAGGGGGACAGGTAGCAAAGGG + Intergenic
914216650 1:145636849-145636871 GCAGGGGGGGTGGTGGCTAAGGG - Intronic
916206347 1:162319493-162319515 ACAGAAGGACTGGTGGGAGATGG - Intronic
917663460 1:177200457-177200479 GCAGGAGGAATGGGGTCAGATGG - Intronic
918243104 1:182637264-182637286 GCTGGAGGCCTGGTGGGAAATGG - Intergenic
918259413 1:182782160-182782182 GGAAGAGGACTGCTGGAAAATGG + Intergenic
918647718 1:186921808-186921830 GCAGCAGTACTAGTAGCAAAGGG - Intronic
919974034 1:202599386-202599408 GCAGGAAGGCTGGGGGCTAAGGG - Intronic
920714495 1:208326886-208326908 GAAGGTGGACTGTTGGAAAATGG - Intergenic
920963561 1:210684225-210684247 GCAGGTGGACTGGAAGCAGAGGG - Intronic
921747474 1:218754085-218754107 GCAGCAGTACTAGTAGCAAAGGG - Intergenic
923302056 1:232650514-232650536 GCAGGAAGATTGGAGGCAGAGGG + Intergenic
1062978907 10:1705451-1705473 GCAGGAGGAGAGGCGGCAGATGG + Intronic
1063455494 10:6179611-6179633 CCAGGAGGACTGCAGGCAAGAGG + Intronic
1064863998 10:19858731-19858753 GCAGGAAGACGGGAGGTAAAAGG + Intronic
1067665145 10:48271196-48271218 GCAGAAGGACAGGAGGCAAGGGG - Intronic
1067698350 10:48551427-48551449 GACTGAGGACTGATGGCAAATGG - Intronic
1069069497 10:63978706-63978728 GCAGCAGGGATTGTGGCAAATGG + Intergenic
1069842893 10:71351058-71351080 GCAGGAGGTTTGGGGGCAAAGGG - Intronic
1069898615 10:71694519-71694541 CCAGGAGGGCAGGTGGCAGAAGG + Intronic
1069939016 10:71940739-71940761 GTAGTAGTACTAGTGGCAAAGGG + Intergenic
1071281705 10:84109745-84109767 GCAGCAGTACTAGTAGCAAAGGG + Intergenic
1072139135 10:92574222-92574244 GCAGGCGGACTGGAGGGACAGGG + Intergenic
1072148547 10:92666024-92666046 TCAGTAGGAGTGGTGGCATAAGG - Intergenic
1072633733 10:97164357-97164379 GCTGGAGGCCTGGGGGCAGAGGG + Intronic
1072792898 10:98331537-98331559 GCAGGATGCCTAGTGGCAAGGGG + Intergenic
1072966920 10:99981782-99981804 GCAGGAGGTCTGAAGGCAGAGGG + Intronic
1073104975 10:101027338-101027360 GCAGGAGCACTGCAGGCAGAGGG - Intronic
1074078726 10:110151544-110151566 GCAGGGGGACTGGGGACAGAGGG - Intergenic
1075105287 10:119536238-119536260 GCAGGAAAGCTGGTGGCAGAGGG + Intronic
1075261740 10:120969316-120969338 GCGGGAGGGTTGGTGGCTAATGG + Intergenic
1075758606 10:124837639-124837661 GCAGGAAGCCTGAAGGCAAATGG + Intergenic
1077026097 11:440689-440711 GCAGGAGGACTGCTGGAACCCGG - Intronic
1077440404 11:2566200-2566222 GCTGGAGGACCCTTGGCAAAGGG - Intronic
1077442321 11:2574521-2574543 GAAGGAGGACTCGGGGCAGACGG - Intronic
1077462808 11:2719066-2719088 GCAGGAGGCCCTGTGGCAAGTGG + Intronic
1078064727 11:8070948-8070970 GCAGGGGGGCTGGAGGGAAAGGG + Intronic
1080063624 11:27983798-27983820 GCATGAAGATGGGTGGCAAATGG + Intergenic
1080847143 11:36036368-36036390 GAAGCAGGACTGCTGGCAAGAGG - Intronic
1081613987 11:44579655-44579677 GCAGGAACACTGGTAACAAAAGG - Intronic
1081830425 11:46106988-46107010 GCTGGAGGACAGTTGGTAAAAGG - Intronic
1082890451 11:58133345-58133367 GCAGGAGGGCTGAAGGCATAAGG + Intronic
1083107972 11:60376771-60376793 GCACCAGGACTGTTTGCAAAGGG + Intronic
1083197126 11:61095007-61095029 GCAGCAGTACTAGTAGCAAAGGG + Intergenic
1083295235 11:61711671-61711693 GTAGCAGGGCTGGTGGCAGATGG + Intronic
1083611330 11:64005812-64005834 GCAGGAGGGCTGGAGACAGAGGG + Intronic
1083750762 11:64759440-64759462 GCAGGTGGGCTGGCTGCAAAGGG - Intronic
1083958694 11:66002088-66002110 GCAGTTGGACTGGTGGGAACTGG - Exonic
1083961803 11:66018747-66018769 GCTGGAGGGCTGGAGGGAAAGGG - Intronic
1084178218 11:67434280-67434302 GCAGCAGGGCTGGTGGCCAGTGG + Intronic
1085129922 11:74029529-74029551 GCAGAAGGCCTGGAGTCAAAGGG - Intronic
1086087910 11:82974100-82974122 GGAGGAGGAGTGATTGCAAATGG + Exonic
1086405777 11:86497923-86497945 GCAGGAGCTCTGGGGCCAAAAGG - Intronic
1087899685 11:103626690-103626712 GCAGAAGGATTGGTTCCAAATGG - Intergenic
1088738670 11:112749140-112749162 GCAGGGGAACTGGGGGCCAAGGG - Intergenic
1089060530 11:115622569-115622591 GCAGGATGAGTGGGGGCAAAGGG + Intergenic
1089188721 11:116638585-116638607 CCAGGAGAACTTGTGGGAAAAGG + Intergenic
1089201685 11:116728394-116728416 GCAGGAGGACAGGTTGCACTGGG - Intergenic
1090743735 11:129690869-129690891 GCAGGGGGCCGGGTGGGAAATGG + Intergenic
1091584824 12:1810217-1810239 GCAGGAGGACTGGAGACATTGGG - Intronic
1091610591 12:2004394-2004416 GCAGGCGGCCTGGTGGGAAAGGG - Exonic
1092377342 12:7966914-7966936 GCAGCAGGAGAGGTGGCAGAGGG + Intergenic
1093288755 12:17298150-17298172 GCAGCAGTACTAGTGGCAAAAGG + Intergenic
1095127164 12:38493350-38493372 GCAGTGGGAATGGTGGTAAAAGG + Intergenic
1096335286 12:50750726-50750748 GGAGGAACACTGGTGGTAAAGGG - Intergenic
1099055305 12:77833096-77833118 GAAGGAGGAATGGTGGGGAAGGG - Intronic
1099165271 12:79298711-79298733 TTAGGATGAGTGGTGGCAAAAGG - Intronic
1100321172 12:93494358-93494380 GCAGAGGGAATGGTGACAAATGG + Intronic
1100981662 12:100167007-100167029 GGAGCAGGACTGGTGTCAGAGGG - Intergenic
1101029774 12:100647311-100647333 GCAGCAGTACTAGTAGCAAAGGG - Intergenic
1103478022 12:121232800-121232822 GGAGGAGGGCTGGGGGCCAAGGG - Intronic
1103882482 12:124176668-124176690 GCAGGAGGACATGTGGAGAAGGG + Intronic
1104292340 12:127482074-127482096 GCAGTAGTACTAGCGGCAAAGGG + Intergenic
1105542529 13:21327454-21327476 GCAGGAGGAGCTGTGGCAGAAGG + Intergenic
1106656044 13:31747292-31747314 GGAAGAGGAGCGGTGGCAAAGGG - Intronic
1106846698 13:33744708-33744730 GAAGTATGACTGGAGGCAAAAGG + Intergenic
1107305489 13:39014011-39014033 GCAGAAGAGCTGGTGGAAAAGGG + Exonic
1108622828 13:52200794-52200816 GCAGGAGGACTTATGGGAGATGG + Intergenic
1108664582 13:52617099-52617121 GCAGGAGAACTGGTTGAACACGG + Intergenic
1108783229 13:53862894-53862916 TCAACAGGACTGGTGTCAAAAGG - Intergenic
1109300999 13:60590071-60590093 GCAGGACAACTGGAAGCAAAGGG - Intergenic
1109802482 13:67398480-67398502 GCAGCAGTACTAGTGGCAAAGGG + Intergenic
1110947827 13:81445381-81445403 GCAGGACAACAGGTGGGAAAAGG + Intergenic
1113854841 13:113437459-113437481 GCAGGAGGACGGATTGCAGAGGG - Intronic
1117502560 14:56367949-56367971 ACAGCAGGAGTGGTGGGAAAAGG - Intergenic
1119319594 14:73721759-73721781 CCAGGAGGATGGGTGGCAATGGG - Intronic
1121833437 14:97071487-97071509 CCAGGGGCATTGGTGGCAAATGG + Intergenic
1122081184 14:99268977-99268999 GCCAGAGGACTGGTGGCAGCTGG - Intronic
1122891223 14:104733154-104733176 GCAGGAAGCCTGGTGGCAGGAGG - Intronic
1123585922 15:21760669-21760691 GCAGGAGGACTGTAGGCCACAGG - Intergenic
1123622563 15:22203259-22203281 GCAGGAGGACTGTAGGCCACAGG - Intergenic
1125466174 15:39955067-39955089 ACAGGAGCACTGGTGGAAACAGG - Intronic
1127868377 15:63049311-63049333 GGAGGAGGACTGCTGAAAAAAGG - Intronic
1129660834 15:77552056-77552078 GCAGGAGCACAGGTGGCACTGGG + Intergenic
1129729015 15:77918929-77918951 GCAGGAGGAGAGGCTGCAAAAGG - Intergenic
1129839485 15:78734941-78734963 GCAGGAGGAAAGGCTGCAAAAGG + Intergenic
1132228605 15:100164680-100164702 GCAGGTGGACTGGCGGGGAAAGG + Intronic
1132592758 16:733545-733567 GCAGGAGGCTTGCTGGGAAATGG - Intronic
1132672825 16:1108687-1108709 GCAAGAGGACTGGGTGCACAGGG + Intergenic
1132734178 16:1377495-1377517 GCAGGGGGAGTGGAGGCAGAGGG - Intronic
1132758071 16:1495646-1495668 CCAAGAAGACGGGTGGCAAAGGG - Intronic
1133636804 16:7674280-7674302 ACATGGGGACTGGTGGCCAAAGG - Intronic
1133656382 16:7868688-7868710 GGAGGAGGGCAGGTGGAAAAGGG - Intergenic
1134044131 16:11088990-11089012 GCAGGTGGCCTGGGGGGAAAGGG - Intronic
1134074935 16:11284015-11284037 GAAAGAGGAGGGGTGGCAAAGGG + Intronic
1134165068 16:11923362-11923384 GCAGGAGTACAGTTGGGAAAGGG + Intergenic
1136344087 16:29664056-29664078 GCAGGATGACTGGTTGCATGAGG - Exonic
1136589204 16:31207232-31207254 GCAGGAGGCCACATGGCAAAGGG - Intergenic
1137436142 16:48455600-48455622 GGAGGAGGACTGGGGGAAAAAGG + Intergenic
1141480550 16:84303807-84303829 GAAGGAGGACTGACGGCTAATGG - Intronic
1141514522 16:84534973-84534995 GGAGGAGGAATGGGGGGAAAAGG - Intronic
1147241089 17:39091019-39091041 GCAGGATGACGGGTGGGAACAGG - Intronic
1152066501 17:78115391-78115413 GCAGGAGGACAAATGGCAATGGG + Intronic
1152615808 17:81337280-81337302 GCAGGAGCACGGGGGGCACAGGG - Intergenic
1153399475 18:4667230-4667252 GCAGTGGTAGTGGTGGCAAAAGG - Intergenic
1153731125 18:8012969-8012991 GGAGGAAGAGTGGTAGCAAAAGG + Intronic
1155809358 18:30212104-30212126 CCAGGAGATCTGGTGGGAAAAGG + Intergenic
1156292036 18:35755772-35755794 GCAGGTGGAGAGGAGGCAAAAGG - Intergenic
1156935695 18:42704117-42704139 GCATGAGGACTGGTTGTAAATGG + Intergenic
1158032240 18:52979894-52979916 ACAGGCGGAGTGGTTGCAAAGGG + Intronic
1158536637 18:58313996-58314018 GGAGGAGGAGAGGTGGCAAGTGG + Intronic
1158589927 18:58770544-58770566 ACAGAAGGACTGGTGGAAAGAGG - Intergenic
1159084135 18:63768791-63768813 GAGGGAGGACAGATGGCAAAGGG - Intronic
1159656738 18:71038018-71038040 GCAGGAGAACTGATGAGAAAAGG - Intergenic
1160714180 19:568204-568226 GCAGGAACACTGGAGGCCAAAGG - Intergenic
1160930151 19:1566617-1566639 GCAGGCGGGCGGGTGGCTAACGG + Intronic
1161447599 19:4327218-4327240 GCAAGAGAACTGGGGGCAGATGG + Exonic
1163943707 19:20517235-20517257 GCAGCAGTACTAGTAGCAAAGGG - Intergenic
1164480492 19:28607812-28607834 GCAGCAGTACTAATGGCAAAGGG + Intergenic
1165282629 19:34810086-34810108 ACAGGATGTCTGGAGGCAAAAGG - Intergenic
1165335549 19:35167304-35167326 GCAGGAGGCCTGGTGAGAGATGG + Intronic
1165926068 19:39327121-39327143 GGAGGAGGACTGGAGACAAGAGG - Intergenic
1166152101 19:40881998-40882020 GCAGGAAGATGGGTGGCACAGGG - Intronic
1166347505 19:42175797-42175819 GCAGGAGGAGAGGTGGAAAACGG - Intronic
1168416458 19:56172153-56172175 GGAGAAGGAATGGGGGCAAAGGG + Intergenic
925859517 2:8161237-8161259 GCAGGAGGCCTGGTGGGAGCCGG + Intergenic
928380184 2:30810834-30810856 GCAGGAGGCGTGGAGGCAAGAGG + Intronic
929556787 2:42930489-42930511 GCATGAGGTCTGGGGGCAGATGG + Intergenic
930517972 2:52432072-52432094 GCAGTAGTACTAGTGGCAAAGGG + Intergenic
931699573 2:64898729-64898751 GTAGAAGTACTAGTGGCAAAGGG - Intergenic
931939703 2:67238706-67238728 GCAGAAGGACAAGTGGCAAAAGG + Intergenic
932606549 2:73169502-73169524 GCAGGAGGTCTGGTGGGGAGAGG + Intergenic
933595633 2:84280436-84280458 GCAGGAGCACTGATGTCCAAGGG + Intergenic
933925877 2:87090933-87090955 GCAGGAGGTCTGGTGGGGAGAGG - Intergenic
933936008 2:87204298-87204320 GCAGCAGTACTAGTAGCAAAGGG - Intergenic
934972912 2:98777483-98777505 GCAGGAGCACTGGGGGAAGATGG + Intergenic
935568510 2:104634904-104634926 ACAGGAGTCCTGGTGGCAACAGG + Intergenic
936115595 2:109700455-109700477 GCAGGAGGACTGGAAGGAAGCGG + Intergenic
936357139 2:111761531-111761553 GCAGCAGTACTAGTAGCAAAGGG + Intergenic
938138178 2:128775959-128775981 GCAGGAGGCCTGGTTGCAAGGGG + Intergenic
938702952 2:133895286-133895308 GCAGTAGTACTAGTGGCAAAGGG + Intergenic
942637375 2:178022168-178022190 GTAGTAGGAGTGGTGGAAAATGG + Intronic
944880374 2:204007131-204007153 GCAGGATTCTTGGTGGCAAAAGG + Intergenic
945307272 2:208269954-208269976 GCATGATGTCTGGTGGCCAAAGG + Intronic
945768120 2:214005198-214005220 GCAGGAGGGCTGGGGTTAAAAGG - Intronic
945815177 2:214596822-214596844 GCAGGGACACTGGAGGCAAATGG - Intergenic
946173869 2:217910968-217910990 GCAGGATGGCTGGGGGCCAAGGG - Intronic
946639958 2:221773511-221773533 GAAGGAGGCTTGCTGGCAAATGG - Intergenic
947088014 2:226477450-226477472 ACAGGAGGACTGCTGGAAGAAGG - Intergenic
948802445 2:240439002-240439024 GCAGGAGGCCTGCTGGCACGCGG - Intronic
948817435 2:240519663-240519685 CCAGGGGGACAGGTGGGAAAAGG + Intronic
948862739 2:240760780-240760802 GCAGCAGGTCGGGTGGCAGAGGG + Exonic
1169560905 20:6799774-6799796 GCAGGAATAAGGGTGGCAAATGG + Intergenic
1171344106 20:24452691-24452713 GAAGGAGGGCTGGAGGGAAAGGG - Intergenic
1172006782 20:31823402-31823424 GCAGGAGGGGTGGTGCCAAGGGG + Intronic
1174433204 20:50486135-50486157 GCAGGAGAATTGCTTGCAAACGG - Intergenic
1175691297 20:61067712-61067734 GCAGTAGAACTGGGGGCAACTGG - Intergenic
1175787538 20:61721409-61721431 GCAGGAGGGCTGGAGGCAGAGGG - Intronic
1176047640 20:63101053-63101075 GCAGCAGGAAGGGAGGCAAAAGG - Intergenic
1176119794 20:63449096-63449118 GCAGGAGGACGGGTGGGCACAGG + Intronic
1177355281 21:19998879-19998901 GCAGCAGTACTAGTAGCAAAGGG - Intergenic
1179124576 21:38579555-38579577 GCATGAGGACTGGAGGAAAGAGG + Intronic
1179254922 21:39707257-39707279 GCAGGAGGACAGCTAGCAAGAGG - Intergenic
1179486724 21:41715362-41715384 AAAGGAGGGCAGGTGGCAAAGGG - Intergenic
1179646909 21:42781868-42781890 GCAGGAGCATGGGTGGCCAAAGG + Intergenic
1179649453 21:42797703-42797725 GCAGGAGGACTGGAAGCCAGGGG - Intergenic
1180216698 21:46328083-46328105 GCTGGAAAACTGGTGGCCAAAGG + Intronic
1181037569 22:20177282-20177304 GCAGGAGGACTTCAGCCAAAGGG - Intergenic
1181096297 22:20507539-20507561 GAAGGAGGGCTTGTGGGAAATGG - Intronic
1182964110 22:34505349-34505371 GCAAGAGGGCTGTTGGAAAAGGG + Intergenic
1183355845 22:37358964-37358986 GCAGGAGGACTGGGGGCCGCTGG + Intergenic
1183658097 22:39202308-39202330 GCAGGAGGACTGCTTGAAACCGG + Intergenic
1184236360 22:43185354-43185376 GCAGGAGGGCTGATGGCCAGGGG + Intronic
1184567054 22:45298431-45298453 GCAAGAGGAGAGGTGGCCAAGGG + Intergenic
1184666536 22:45992285-45992307 TCACCAGGACTGGTGGCAGAAGG + Intergenic
1185302250 22:50088017-50088039 GCATGAGGGCTGGTGGCTCATGG - Intergenic
949157597 3:847910-847932 GCAGTAGTACTAGTGGCAAAGGG + Intergenic
949840605 3:8315865-8315887 GCAGGAGGGCTGAAGGCATAAGG - Intergenic
950053575 3:10009304-10009326 GGAGGAGGTCTGGGGGGAAAGGG - Intronic
950305223 3:11911592-11911614 GGAGGAGGTCTGGGGGAAAAGGG - Intergenic
950526864 3:13529349-13529371 GCAGGAGGGATGGAGGGAAAAGG - Intergenic
950678150 3:14567087-14567109 GCAGCAGGACTGAGGGCAAAGGG - Intergenic
951166509 3:19489352-19489374 GCAGCAGTACTAGTAGCAAAGGG - Intronic
952218422 3:31300630-31300652 GCAGGAGTGCTGTTGGCAGATGG - Intergenic
953021591 3:39117772-39117794 GCAGGAGGAAAGGGGGGAAAGGG + Intronic
953363457 3:42321744-42321766 GCAGAAGGAATGTTGGCAGAAGG - Intergenic
953391182 3:42534764-42534786 CCAGGAGGGCTGGGGGCAGAAGG + Intronic
954039730 3:47875878-47875900 GCAGGTTGAGTGGTGGCCAAAGG + Exonic
957021953 3:75137535-75137557 GCAGCAGTACTAGTGGCAAAAGG + Intergenic
957405769 3:79774189-79774211 GCAGCAGTACTAGTAGCAAAGGG + Intergenic
958126278 3:89360162-89360184 GTAGGAGTCCTGGTGGCATATGG - Intronic
959587392 3:108037606-108037628 TCAGGAGGACTGATGGAACAAGG + Intergenic
960575921 3:119229252-119229274 GGAGGAGGACAGGAGGCACATGG + Intronic
960838241 3:121929462-121929484 CCAGGGGCACTGGTGTCAAAAGG + Intronic
961740548 3:129030868-129030890 GCAGGAAGACTGGGCGCACAGGG - Intronic
961810935 3:129521302-129521324 GCAGGTGGACTGGGGGTGAAAGG - Intergenic
962368029 3:134798415-134798437 GCAGGAGGACTGTTGGCTTAGGG + Intronic
963083129 3:141413078-141413100 GGAGGAGGAATTGTGGGAAATGG + Intronic
965422618 3:168480771-168480793 GCAGGAGCACTGGTGCTCAAGGG + Intergenic
966853932 3:184181236-184181258 GCAGGAGAGCTGGTGGGAGAGGG + Intronic
967131948 3:186478682-186478704 GAAGGAGGAATGGAGGCAAAAGG - Intergenic
967252819 3:187560425-187560447 GCAAGAGGATTGGTGGAAGACGG - Intergenic
967253674 3:187568458-187568480 GGAAGTGGACTGGTGGCACAGGG + Intergenic
967949922 3:194832920-194832942 CCAGGAGTTCAGGTGGCAAAAGG + Intergenic
968914755 4:3492525-3492547 GTAGGAGAACAGGTGGCAGAAGG + Intronic
969053965 4:4390280-4390302 GCAGGAGCACTGGGTGGAAAAGG + Intronic
969639397 4:8388010-8388032 GCAAGAGGCCTGGTGGAAAGGGG - Intronic
969932160 4:10641240-10641262 GCTGGAGGACTGGTATGAAAGGG + Intronic
970249022 4:14094492-14094514 ATAGGAGGGCTGGTGGGAAAGGG - Intergenic
971304027 4:25464712-25464734 GCAGGAGGACTGCTGGAACCTGG + Intergenic
971474806 4:27062568-27062590 GCAGGAGGACTGATGACCAAAGG + Intergenic
972076974 4:35101842-35101864 GCAGCAGTACTAGTAGCAAAGGG + Intergenic
972170566 4:36340903-36340925 GAAGGAAGACAGCTGGCAAAGGG + Intronic
975298658 4:72764576-72764598 GCTGGAGGCCTTGTGGCCAAAGG - Intergenic
976350143 4:84051632-84051654 GGAGAAGCACTGGTGGCAAAGGG + Intergenic
976970519 4:91096434-91096456 GCAGCAGTACTAGTAGCAAAGGG - Intronic
977354984 4:95934084-95934106 GCAGGAGGGCAGAGGGCAAAAGG + Intergenic
979271342 4:118766253-118766275 GCAGGAAGACAGGGGCCAAAGGG - Intronic
979708304 4:123747628-123747650 GCAGCAGGACAGCAGGCAAAGGG + Intergenic
981073093 4:140565713-140565735 GCAGGAGTACTCCAGGCAAAGGG - Intronic
981153389 4:141405289-141405311 GCAACAGAACTGGTGGAAAATGG - Intergenic
982114052 4:152082448-152082470 GCAGGAGGAATGGGGGCTTAGGG + Intergenic
984628484 4:182035880-182035902 GCAGGAGGTTGGGTGTCAAAGGG - Intergenic
984891744 4:184500078-184500100 CCAGGAGCACTGATGGCTAAGGG + Intergenic
985987139 5:3525361-3525383 GCAGGAGAGCTGGTGGTGAAGGG + Intergenic
986241605 5:5965017-5965039 GACAGAGGACTGGAGGCAAAGGG - Intergenic
986821242 5:11469136-11469158 GCACAAAGACTGGAGGCAAAGGG - Intronic
989382781 5:40825680-40825702 GGAAGAGGCCAGGTGGCAAATGG - Exonic
990210500 5:53478680-53478702 GTTGGAGGACTGGAGGGAAAGGG + Intergenic
992490481 5:77238802-77238824 CCAGGAGCACTGATGGCCAAGGG + Intronic
993328347 5:86568343-86568365 GCAGCAGTACTAGTGGCAAAGGG - Intergenic
995250177 5:109984201-109984223 GCAGGGGTAGTGGTGGGAAATGG + Intergenic
996804680 5:127441255-127441277 GGAGGAGGGCTGGTGGCCCAGGG + Intronic
997258506 5:132447480-132447502 GCAGGAGGGCTGGAAGCAGAGGG - Intronic
998335865 5:141371743-141371765 GTAGGAGGCCTGGTGGAAAACGG - Exonic
999848828 5:155515415-155515437 GCTGGAGGACAGGGGACAAAGGG + Intergenic
1000038988 5:157471049-157471071 TCAGGAGGACTGGGGGCAGTGGG + Intronic
1001640164 5:173238383-173238405 TCAGCAGGGCTGGTCGCAAAAGG + Intergenic
1001997492 5:176173904-176173926 GCAGGAGGTCTGATGACACAGGG + Intergenic
1003409484 6:5850363-5850385 GCAGGAGGAGCTGTGGCAGAAGG - Intergenic
1004738463 6:18432362-18432384 TCAGGAGGACTTGTGGCTAGAGG + Intronic
1005637610 6:27766605-27766627 GCAGGAGGAGTACTGGGAAAGGG + Intergenic
1007611245 6:43150714-43150736 TCAGGTGCACTGGTGGTAAAGGG - Intronic
1007925050 6:45643660-45643682 GTTGGAGGACTGGTGGGAGAAGG - Intronic
1008071457 6:47103028-47103050 GCAGGAGGAAAGGAAGCAAATGG + Intergenic
1009385226 6:63079099-63079121 GCAGGAGGTCTGGGGGTGAATGG + Intergenic
1009996664 6:70902902-70902924 GCAGGGGGGCTGGTGGTCAAAGG + Intronic
1011414241 6:87101109-87101131 GTAGAAGGACTGCTGGCTAATGG - Intergenic
1011564803 6:88663484-88663506 GCAGCAGTACTAGTAGCAAAGGG + Intronic
1012612236 6:101230549-101230571 GCAGTAGTACTAGTGGCAAAGGG - Intergenic
1013673464 6:112430764-112430786 GCAGGAGGGCTGGCAGCACAGGG + Intergenic
1014302172 6:119695121-119695143 GCAGGAGGATTGGTTGAAACTGG + Intergenic
1017805229 6:157940024-157940046 GCAGGAGGACTGGATGCTGAGGG - Intronic
1017985156 6:159437072-159437094 GCAGCAGGAATGGAGGCAGATGG + Intergenic
1019058509 6:169239663-169239685 GCAGGTGATTTGGTGGCAAATGG + Exonic
1019472216 7:1227137-1227159 GCAAGAGGACTGGAGGCCTAGGG + Intergenic
1019703639 7:2487376-2487398 GGAGGAGGAATGCTGGCACAGGG + Intergenic
1020787956 7:12592734-12592756 GTAAGAGGTCTGGTGGCAAGCGG + Intronic
1021849535 7:24794442-24794464 GCAGTAGTACTAGTGACAAAGGG - Intergenic
1023633134 7:42183341-42183363 GCACAAGGACAGGTGGCAACAGG + Intronic
1026066760 7:67081548-67081570 GAAGGAGAACAGGTGGGAAAAGG - Intronic
1026341867 7:69441316-69441338 GGAGGAGGATGGGTGGAAAAAGG - Intergenic
1026728443 7:72890665-72890687 CCAGGAGGAGTGGTGGCAACTGG + Exonic
1027115390 7:75475128-75475150 CCAGGAGGAGTGGCGGCAACTGG - Exonic
1027120574 7:75516160-75516182 CCAGGAGGAGTGGCGGCAACTGG - Intergenic
1027286516 7:76650822-76650844 CCAGGAGGAGTGGCGGCAACTGG - Intergenic
1029517764 7:101037441-101037463 GCAGGAGTGCTGGTGTCAACAGG - Exonic
1029688708 7:102166156-102166178 GCAAGGGGACTGGTGGCCACGGG - Intronic
1030689484 7:112517746-112517768 GCAGCAGCAGTGGTGGTAAAGGG + Intergenic
1031974896 7:128087336-128087358 GCAGGAGGTGAGGTGGGAAAGGG + Intronic
1033534292 7:142298093-142298115 TCAGGAGGACTGAGGGCAGATGG + Intergenic
1034821058 7:154216524-154216546 GGAGAAGGATTGGTAGCAAATGG + Intronic
1035369664 7:158371999-158372021 CCAGGAGGGCTGATGGCAGAGGG - Intronic
1035522640 8:287393-287415 GCAGGAGGCCTGGTGGCATGGGG + Intergenic
1035626673 8:1076211-1076233 GCAGGAAGGCGGGTGGCACAGGG - Intergenic
1036435155 8:8726094-8726116 CCAGGAGCTGTGGTGGCAAAAGG + Intergenic
1038563079 8:28597350-28597372 GGAGGAGGAGAGGTGGGAAAGGG - Intergenic
1039091669 8:33836363-33836385 CCAGGAGCACTGGTGTCCAAGGG - Intergenic
1040877479 8:52168194-52168216 GCAGGAGGACAGGAGGCTATCGG + Intronic
1040915742 8:52565211-52565233 GCAGGAAGAGTGCGGGCAAAGGG + Exonic
1040924109 8:52658481-52658503 GCAGGAGAACTGCTGGAACATGG + Intronic
1042177184 8:66048276-66048298 GGAGAAGGGCTGGTGGCAGAAGG - Intronic
1042532736 8:69832420-69832442 GCAGAGGGACTGGGGGCCAACGG + Exonic
1043506078 8:80904478-80904500 GCTTGAGGACTGGTGGGATACGG - Intergenic
1045651571 8:104346353-104346375 GCAGGAGGACTGCGGGCAGGTGG - Intronic
1045815304 8:106270816-106270838 GCAGGAGGATGGGTGGAAAGTGG + Intronic
1046440589 8:114247884-114247906 GCAGGAAGACTGGAAGCAGAAGG - Intergenic
1047299168 8:123598029-123598051 GCTGGAAGACTGATGGCAGAAGG - Intergenic
1047309264 8:123677870-123677892 GCAGGCGGGCTGGGGGCACAGGG + Intergenic
1047984228 8:130215829-130215851 GCAGGAGGACTGCTGGAGACTGG + Intronic
1048091439 8:131245159-131245181 GCAGAAGGACTGCTGGAAAGAGG - Intergenic
1048587971 8:135792718-135792740 GCAGCAGGACAGGAGGCAGAAGG - Intergenic
1048658427 8:136570046-136570068 GCAGGAGGATTTGTGCAAAAGGG - Intergenic
1049253200 8:141600244-141600266 AAAGGAGGAGTGGTGGCAGAGGG + Intergenic
1049527175 8:143133279-143133301 GCAGCTGGACTGGAGGCAGAGGG - Intergenic
1049762901 8:144338911-144338933 TCAAGGGGACTGGGGGCAAAAGG - Intergenic
1050298833 9:4235592-4235614 ACAGGAGGACTGCTGGCTATTGG - Intronic
1054737513 9:68770377-68770399 GCAGGAGGACTGGTGGCAAAAGG - Intronic
1056541037 9:87571650-87571672 GAAGGTGGACTGCTGGCAGACGG - Intronic
1057635637 9:96763572-96763594 CCAGGAGGAGTGGCAGCAAATGG - Exonic
1057822426 9:98342759-98342781 ACAGGTGGCCTGGTGGCCAAAGG - Intronic
1058111761 9:101038308-101038330 ACATGAGGACTGATGGCCAAAGG - Intronic
1058663162 9:107283913-107283935 GCCGAAGGCCTGGTGGCAGATGG + Intronic
1058720396 9:107758989-107759011 ACAGGAGGACTCTTGGCCAAGGG - Intergenic
1058731017 9:107849953-107849975 GAAGGATGACTGATGTCAAAGGG + Intergenic
1059395605 9:114032353-114032375 GCAGGAGAGCAGATGGCAAATGG - Intronic
1059721875 9:116967841-116967863 GCAGGAGCATTGATGGCAGAAGG - Intronic
1060551527 9:124487721-124487743 GCTGGAGGTCTGCTGGCAAGTGG + Intronic
1060884365 9:127140191-127140213 GCAGGAGGAAAAGTGGTAAAAGG - Intronic
1061673322 9:132201514-132201536 GACACAGGACTGGTGGCAAAGGG + Intronic
1061676142 9:132216839-132216861 CCAGGAGGGCACGTGGCAAAGGG + Intronic
1061862582 9:133475603-133475625 GCAGGAGGCCTGGGGGCGAGGGG + Exonic
1185909443 X:3968717-3968739 GCAGCAGTACTAGTAGCAAAGGG + Intergenic
1187854624 X:23624936-23624958 GCAGGAGGACTGCTGGAACCCGG - Intergenic
1188251356 X:27898786-27898808 GAAGGGGGACTGGTGGTCAAAGG + Intergenic
1189208361 X:39261656-39261678 GGAGGAGGACTGGTAGAAATGGG + Intergenic
1190075535 X:47314384-47314406 GCAGGAGGACTGCTTGAAACTGG - Intergenic
1190315449 X:49147657-49147679 GCAGCAGTACTAGTGGCAAAGGG - Intergenic
1190426362 X:50337393-50337415 GCAGCAGTACTAGTAGCAAAGGG - Intronic
1190474035 X:50810492-50810514 GCAGGAAGCATGGTGGAAAATGG - Intronic
1191036526 X:56030864-56030886 GCAGCAGTACTAGTAGCAAAGGG - Intergenic
1193069677 X:77294861-77294883 GCAGCAGTACTAGTAGCAAAGGG + Intergenic
1194839359 X:98720609-98720631 CCAGGAGGACTGATGTCTAAGGG + Intergenic
1195716772 X:107826024-107826046 GGAGGCGGAGTGGGGGCAAACGG - Exonic
1197651918 X:129074370-129074392 GCACGAAGCCTGGTGGCAAGGGG + Intergenic
1198801593 X:140453215-140453237 GCACTATGACTTGTGGCAAATGG + Intergenic
1198969563 X:142266504-142266526 GCAGCAGTACTAGTAGCAAAGGG + Intergenic
1200033057 X:153311877-153311899 GCCGGAGGACAGGTGGCATGTGG - Intergenic
1200242654 X:154506032-154506054 GCAGGAGCCCTGGAGACAAAAGG + Intergenic
1200394607 X:155976371-155976393 GCAGCAGTACTAGTAGCAAACGG - Intergenic
1201554660 Y:15255701-15255723 GCAGCAGTACTAGTAGCAAAGGG + Intergenic