ID: 1054737514

View in Genome Browser
Species Human (GRCh38)
Location 9:68770384-68770406
Sequence GCAAGGTGCAGGAGGACTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 311}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054737514_1054737525 9 Left 1054737514 9:68770384-68770406 CCACCAGTCCTCCTGCACCTTGC 0: 1
1: 0
2: 3
3: 26
4: 311
Right 1054737525 9:68770416-68770438 GACTTCTCAGGGTAAAAATAAGG No data
1054737514_1054737527 24 Left 1054737514 9:68770384-68770406 CCACCAGTCCTCCTGCACCTTGC 0: 1
1: 0
2: 3
3: 26
4: 311
Right 1054737527 9:68770431-68770453 AAATAAGGATGAAGGAGAGAAGG No data
1054737514_1054737524 -2 Left 1054737514 9:68770384-68770406 CCACCAGTCCTCCTGCACCTTGC 0: 1
1: 0
2: 3
3: 26
4: 311
Right 1054737524 9:68770405-68770427 GCTGGGGGTCTGACTTCTCAGGG No data
1054737514_1054737523 -3 Left 1054737514 9:68770384-68770406 CCACCAGTCCTCCTGCACCTTGC 0: 1
1: 0
2: 3
3: 26
4: 311
Right 1054737523 9:68770404-68770426 TGCTGGGGGTCTGACTTCTCAGG No data
1054737514_1054737526 16 Left 1054737514 9:68770384-68770406 CCACCAGTCCTCCTGCACCTTGC 0: 1
1: 0
2: 3
3: 26
4: 311
Right 1054737526 9:68770423-68770445 CAGGGTAAAAATAAGGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054737514 Original CRISPR GCAAGGTGCAGGAGGACTGG TGG (reversed) Intronic
900096161 1:940986-941008 GCACGGGGCAGGAGGATGGGCGG - Intronic
901032250 1:6314037-6314059 GCAACGTGGAGGAGGACTGAAGG + Intronic
901103275 1:6735890-6735912 GCAGGGAACAGGAGGCCTGGAGG - Intergenic
901934446 1:12617985-12618007 GCAACGTGCAGGAGAAGTGGGGG + Intergenic
901949392 1:12729904-12729926 GCAAGGTGAAGGAGAGCTGATGG - Intergenic
903101589 1:21035236-21035258 GTAAGGTGCAGGTGGCATGGTGG - Intronic
903844858 1:26273011-26273033 GAAAGGTCCAGGGGGACTGTTGG + Intronic
903952496 1:27004497-27004519 GGAAGGAGCTGGAGGACTGAGGG + Intergenic
904460588 1:30677318-30677340 TCAAGGGGCAGGAGGTGTGGTGG - Intergenic
904944387 1:34188720-34188742 GGAGGGTGGAGGAGGGCTGGGGG + Intronic
905221169 1:36448963-36448985 GCAATGTGCAGAATGAATGGAGG + Intronic
905253010 1:36661801-36661823 GAAAGATCCAGGTGGACTGGTGG - Intergenic
905330414 1:37191344-37191366 GCGAGGTACAGGATGCCTGGAGG + Intergenic
905533654 1:38701803-38701825 GCAAGGCTCAGGAGACCTGGAGG + Intergenic
907467597 1:54649522-54649544 GGATGGAGGAGGAGGACTGGGGG + Intronic
907858387 1:58326437-58326459 CCATCGTGCAGGAGGACTTGAGG + Intronic
909793279 1:79701562-79701584 GCAGAGAGCAGGAGGACGGGGGG + Intergenic
910373486 1:86543529-86543551 GCAGGGAGCAGGAGGAAGGGAGG + Intergenic
916165788 1:161966228-161966250 GCAAGGTCCAGCAGTACTCGAGG + Intergenic
916833734 1:168520409-168520431 GGTAGGTGCAGGAGGGCAGGGGG - Intergenic
919046267 1:192456497-192456519 GCCAGATGAAGGAGGATTGGTGG + Intergenic
919927055 1:202197117-202197139 GGAATGTGCAAGAGGACTTGCGG - Intronic
920211679 1:204333094-204333116 GCAGGGTGCCCGAGGCCTGGGGG - Intronic
920844269 1:209580488-209580510 GCAGGGTGCAGGTGAATTGGAGG + Intergenic
924087141 1:240464100-240464122 GCCAGTTAAAGGAGGACTGGTGG + Intronic
924537146 1:244945404-244945426 GCAAGGTGAAAGAGTTCTGGAGG + Intergenic
1063703043 10:8404170-8404192 GCAGGGGGCAGGAGGACAGGAGG + Intergenic
1064173164 10:13051709-13051731 GCGTGGGGCAGGAGGACTGGGGG + Intronic
1065307372 10:24381805-24381827 GACAGGTGCAGCAGGGCTGGTGG - Intronic
1067024312 10:42830364-42830386 GCAAGGTGCCAAAGGACAGGCGG + Exonic
1067185121 10:44020898-44020920 TCGCTGTGCAGGAGGACTGGGGG - Intergenic
1070660951 10:78304843-78304865 GTAAGGGGCACCAGGACTGGTGG - Intergenic
1070822090 10:79363559-79363581 GAAAAGTGCAGGAGGAATGTAGG - Intergenic
1071497415 10:86178699-86178721 GAAAGGGCCAGGAGGCCTGGAGG - Intronic
1072804357 10:98415251-98415273 GCATGGTGGAGGGGGCCTGGAGG - Intergenic
1073244894 10:102082857-102082879 GCTAGGTGCAGTGGGAGTGGTGG - Intergenic
1073251634 10:102123419-102123441 ACAATGTCCTGGAGGACTGGAGG + Intergenic
1073329327 10:102660516-102660538 CCAGGGTGCAGGATGCCTGGGGG + Intergenic
1074113984 10:110442131-110442153 GGAAGGGTCAGGAGGGCTGGGGG - Intergenic
1074733317 10:116400835-116400857 GCATGATGAAGGAGGACTGGAGG + Intergenic
1074887020 10:117701827-117701849 CCCAGGAGCAGGAGGACTGAAGG - Intergenic
1075903637 10:126063044-126063066 GCAGGGGGCAGGAGCAGTGGGGG - Intronic
1076807493 10:132866374-132866396 CCAGGGTGCAGGAGGTCTGTCGG - Intronic
1077528551 11:3083788-3083810 GCAGAGTGCAGGAGCAATGGTGG - Intergenic
1077905380 11:6528888-6528910 GCAAGGTGCAGGAATTCTGCAGG + Exonic
1080002503 11:27365306-27365328 GCAAGGGGCAGAGGGATTGGAGG + Intergenic
1080753000 11:35167882-35167904 GTAAAGGGCAGGAGGCCTGGGGG + Intronic
1081593692 11:44444652-44444674 GGAAGATGCTAGAGGACTGGAGG - Intergenic
1081704350 11:45172235-45172257 GCAAGGTGCTGGAAGGGTGGAGG - Intronic
1082819672 11:57536484-57536506 GCTTGGGGTAGGAGGACTGGGGG + Intergenic
1083452015 11:62752596-62752618 CCCAGGGGCAGCAGGACTGGAGG - Exonic
1084105009 11:66975415-66975437 GAAAGCTGCAGGAGCCCTGGGGG + Exonic
1085045403 11:73349822-73349844 GCAAGGTGGAGGTGGACAGGAGG + Intronic
1085075059 11:73583758-73583780 GCAAACTTCAGGAGTACTGGAGG + Intronic
1085166709 11:74407521-74407543 GCAAGGTGTGGGAGCACGGGTGG + Intergenic
1087172900 11:95068095-95068117 GCAACGTGATGGAGGACTTGGGG + Exonic
1088329545 11:108636251-108636273 CCAAGGTGGAGGATGACTTGAGG + Intergenic
1088828283 11:113514044-113514066 CCTAGGACCAGGAGGACTGGAGG - Intergenic
1089432594 11:118436383-118436405 GCAGGGTGCAGGCGGCCGGGCGG + Intergenic
1091743606 12:2976970-2976992 GGAAGGAGCAGGAGGCCTGCAGG - Intronic
1091910958 12:4230341-4230363 GCAAGGTGCCTGTGGATTGGAGG + Intergenic
1092063452 12:5569430-5569452 GGAAAATGAAGGAGGACTGGAGG - Intronic
1093680369 12:21995526-21995548 GCAAGATGCAGGTGGGGTGGAGG + Intergenic
1096785896 12:54017125-54017147 CCAAGGGGCAGGAGGAATGCAGG + Intronic
1098516466 12:71382338-71382360 GCAACTAGCAGGAGGACTTGAGG + Intronic
1099596349 12:84671653-84671675 GTGGGGTGCAGGAGGCCTGGAGG - Intergenic
1099988474 12:89697353-89697375 GCAAAGTAGAGGATGACTGGAGG + Intronic
1100726346 12:97413085-97413107 GCAAGATGAAGAAGGACTTGTGG + Intergenic
1101123832 12:101610795-101610817 ACAAGGCAGAGGAGGACTGGTGG - Intronic
1102466723 12:113134747-113134769 GCCAGGTGCAATGGGACTGGGGG - Intronic
1103792163 12:123479450-123479472 GGTAGGTGCAGGAGGAATGAAGG + Intronic
1103910665 12:124350279-124350301 GTACGGTGCTGGAGGCCTGGCGG + Intronic
1104963124 12:132497617-132497639 GACAGGGGCAGGAGGCCTGGGGG - Intronic
1105278443 13:18949505-18949527 GCAAGGCCCAGAAAGACTGGAGG + Intergenic
1110741552 13:79003324-79003346 GCAACCTGCAGGAGGGCAGGTGG + Intergenic
1111231798 13:85354018-85354040 GGAAGGACCAGGATGACTGGCGG + Intergenic
1112367953 13:98771917-98771939 GTAAGGGGCAGGAGGACTTGGGG + Intergenic
1112610402 13:100949499-100949521 CCACGGTGAAGGAGGGCTGGAGG + Intergenic
1113285624 13:108845407-108845429 TCAAGGTGCAGGTTGACTGAAGG + Intronic
1113747502 13:112755219-112755241 GCAGGCTGCACGTGGACTGGGGG + Intronic
1113756116 13:112812321-112812343 GCAGGGTGCACGAGGACCAGTGG - Intronic
1113764031 13:112869753-112869775 GCAAGGTGCTGGAGGGCGGGAGG - Intronic
1113877159 13:113601637-113601659 CCAGGGTCCAGGAGGACTCGTGG + Intronic
1114654197 14:24306264-24306286 ACCAGGTGCAGGAGGAGTTGTGG - Exonic
1115145987 14:30226473-30226495 GCATGGGGCAGGAGGTGTGGCGG - Intergenic
1117538454 14:56723960-56723982 GCGACGGGCAGAAGGACTGGAGG - Intronic
1118473294 14:66094399-66094421 ACAAGGTGCAGGTGGCATGGCGG + Intergenic
1118839957 14:69502545-69502567 CCCAGGTGCAGCAGGCCTGGGGG + Intronic
1119851123 14:77867344-77867366 GCCATGTACAGGAGGACTAGGGG + Intronic
1121573734 14:94966745-94966767 GAAAGGTGTGAGAGGACTGGAGG + Intergenic
1122817623 14:104321379-104321401 GAGAGGCGCAGGGGGACTGGAGG - Intergenic
1123585923 15:21760676-21760698 GAAAGAAGCAGGAGGACTGTAGG - Intergenic
1123622564 15:22203266-22203288 GAAAGAAGCAGGAGGACTGTAGG - Intergenic
1123828381 15:24106686-24106708 GCCGGGTCCAGGAAGACTGGAGG + Intergenic
1123858372 15:24436485-24436507 GCAGGGTCCAGGAAGACTGGAGG + Intergenic
1123863000 15:24486949-24486971 GCAGGGTCCAGGAAGACTGGAGG + Intergenic
1124366157 15:29072802-29072824 GGTAGGGGCAGCAGGACTGGGGG + Intronic
1125725437 15:41866095-41866117 GCCAGGAGCTGGAGGACAGGCGG - Exonic
1125892158 15:43274856-43274878 GGAAGGAGAAGGAGGACTAGGGG + Intergenic
1127300426 15:57647719-57647741 GCCAAGTGCAGGAGGTGTGGAGG - Intronic
1127967407 15:63932731-63932753 GCAGGATGCAAGAGGACAGGAGG - Intronic
1129136317 15:73555399-73555421 ACAAGGTGCAGGAGGTCTGGAGG - Intronic
1129240058 15:74245705-74245727 GGAGGGTGCAGGAGGACTCGGGG - Intronic
1129302166 15:74631691-74631713 GCAAAGGGCTGGAGGAGTGGTGG + Exonic
1131091394 15:89627272-89627294 GGAAGTTGCAGGAGGAGAGGTGG + Exonic
1132759477 16:1501798-1501820 GCAGCGTGCAGGAGGCCGGGAGG + Intronic
1132844413 16:1993250-1993272 GCCAGGTGCTGAGGGACTGGGGG - Exonic
1132998318 16:2835869-2835891 GGAAGTGGCAGGAGGACTGTGGG - Intronic
1133218246 16:4306577-4306599 GTGAGGTGCAGAAGGCCTGGGGG - Intergenic
1133249224 16:4469337-4469359 GCAAGGTGCAGAAGTAGTGCAGG - Exonic
1133281249 16:4666678-4666700 GGAAGGAGCAGCAGGACTGGGGG - Intronic
1135298406 16:21302588-21302610 GAAAGGTGCTGGAGGGCTGTCGG + Intronic
1135634410 16:24061882-24061904 TTAAGGTGCAGGGGGAGTGGGGG - Intronic
1137363199 16:47839207-47839229 GTAAAGAGCAGGAGGACAGGGGG - Intergenic
1137416875 16:48290684-48290706 CCCAGGTGCAAGAAGACTGGTGG - Intronic
1137536214 16:49328479-49328501 GCAAGATGCTGGAGCACTAGGGG - Intergenic
1138326224 16:56171876-56171898 AAAAGGAGGAGGAGGACTGGAGG - Intergenic
1140427853 16:74875634-74875656 GAAAGGGGCAGGTGGACTGAAGG - Intronic
1142304617 16:89278441-89278463 GCAAGGAGCTGGGGGAGTGGGGG + Intronic
1142349188 16:89571936-89571958 ACAAGGGGCAGGAGGGATGGCGG + Intergenic
1143531899 17:7510106-7510128 GCAAGCTGCAGGAGCCTTGGGGG - Intronic
1144243377 17:13336170-13336192 GCAAGGTGCAGGGGTAGGGGTGG - Intergenic
1145065092 17:19756760-19756782 GCAAGGTCGAGAAGGGCTGGGGG - Intergenic
1145368469 17:22286606-22286628 GCGAGGTGCAGGTGGCATGGGGG - Intergenic
1146659169 17:34653154-34653176 CCATGGGGCAGGAGGTCTGGGGG - Intergenic
1147316987 17:39625706-39625728 AAAAGCTGCAGGAGGATTGGGGG + Intergenic
1147455688 17:40536739-40536761 GGAAGGTGTAGGAGGAAAGGGGG + Intergenic
1147471518 17:40666480-40666502 GGAAGGTGCAGGAGGTAGGGAGG - Intergenic
1147665010 17:42141270-42141292 GCAAGGGGCTGGAGAACTTGGGG + Intronic
1147770837 17:42866890-42866912 GCAAGGTGCAAGAGGAAGTGGGG - Intergenic
1148216229 17:45835337-45835359 GTAAGGTTCTGGAGGCCTGGGGG - Exonic
1148678003 17:49456165-49456187 GCAAGGTGAAGGAAGTCAGGAGG + Intronic
1148972650 17:51497959-51497981 GCAGGGAGCAGCAGGAATGGTGG - Intergenic
1149350426 17:55781258-55781280 GCATGGGGCAGGAGAACGGGAGG - Intronic
1151729354 17:75901776-75901798 GCCACGTGCAGGGGGACTCGGGG + Exonic
1152018707 17:77769184-77769206 GCCAGGGGCAGCAGGGCTGGGGG + Intergenic
1152277635 17:79367378-79367400 TTGAGGTGGAGGAGGACTGGAGG - Intronic
1152564513 17:81094170-81094192 GCAAGATGCAGGAGAAGTGGGGG - Intronic
1152615811 17:81337287-81337309 CCCAGGTGCAGGAGCACGGGGGG - Intergenic
1152648164 17:81479834-81479856 GCAAGGAGGAGTAGGAGTGGTGG - Intergenic
1153503103 18:5768690-5768712 ACCAGGTGCAGGAGCACTCGGGG + Intergenic
1156341794 18:36215887-36215909 GAAAGCTGCAGGAGTCCTGGAGG + Exonic
1157425945 18:47584373-47584395 GCAAGGAGGAGGAGGATTGTAGG + Intergenic
1157488634 18:48107244-48107266 GGAAGGTTCAGGAGGAAGGGAGG + Intronic
1157674990 18:49562186-49562208 GCCAGGGGCTGGGGGACTGGAGG - Exonic
1161044375 19:2127220-2127242 GGAAGCGGCATGAGGACTGGGGG + Intronic
1161447598 19:4327211-4327233 GGGAGGTGCAAGAGAACTGGGGG + Exonic
1161615590 19:5268506-5268528 GCAAGCAGCAGGAGGGCAGGAGG + Intronic
1162380632 19:10329658-10329680 GCAGGGTTCAGGGGCACTGGTGG - Intronic
1163768766 19:19178288-19178310 GGCAGGTGCAGGAGGAATGCTGG + Intronic
1163883958 19:19949846-19949868 GGAGGGTGCTGGAGGATTGGTGG - Intergenic
1165343303 19:35227531-35227553 TTAAGGGGCAGGTGGACTGGGGG + Intronic
1165389704 19:35531398-35531420 CCAAGGTTCAGGGGGAGTGGGGG - Intergenic
1165726349 19:38115576-38115598 GCAAGGAGCAGGAGGCCATGAGG - Intronic
1166095014 19:40532801-40532823 GCCAGGTGCAGGAGGCCTCCAGG + Intronic
1166332668 19:42088015-42088037 GCAAGGGGCTGGGGGGCTGGAGG - Intronic
1166964789 19:46522583-46522605 GAAAAGAGCAGGATGACTGGAGG - Intronic
1167620015 19:50555510-50555532 GAAAGGGGCAGGAGGACAGGAGG + Intronic
924959773 2:23872-23894 GCAAGAAGCATGAGGACTGATGG - Intergenic
926113667 2:10197655-10197677 GAAAGGACCAGGAGCACTGGGGG - Intronic
926276472 2:11407067-11407089 AAAAGGGGCAGGAGGAATGGAGG - Intergenic
927872374 2:26631771-26631793 GGAAGCTCCAGGAGGACTGGAGG + Intronic
928229279 2:29482398-29482420 TCAAGGTGAAGGAGAACTGAGGG + Intronic
928265937 2:29811951-29811973 GCAAGGGGCAGGAAAACTGAAGG + Intronic
928928265 2:36599574-36599596 GCAAAGAGCAGGAGGACAGGGGG - Intronic
929209977 2:39345282-39345304 GCAGGGTGCAGGGGGTCGGGGGG + Intronic
929441268 2:41967294-41967316 GGCTGGTGCAGGAGGAATGGAGG + Intergenic
929569476 2:43011753-43011775 GCCAGGGGCTGGAGGAGTGGAGG - Intergenic
929592183 2:43154582-43154604 GAAAGGTGGAGGAGGACAGATGG + Intergenic
930487602 2:52027117-52027139 GCAAAGAGCAGGAGGACAGGGGG + Intergenic
931669195 2:64631312-64631334 GCAAGAGGCAGCAGGAATGGAGG + Intergenic
932355906 2:71068420-71068442 GCAGGATCCAGGAGGACGGGAGG + Exonic
932398777 2:71465758-71465780 GCTAGGTGCTGGAGTGCTGGGGG + Intronic
933313243 2:80686284-80686306 ACATGGAGCAGGAGGACTCGTGG - Intergenic
933856138 2:86416264-86416286 GCCAGGGGGAGGAGGACTGGAGG + Intergenic
935378210 2:102422035-102422057 GCATGATGCAGGAAGACAGGAGG - Intronic
936009589 2:108916918-108916940 CCAAGGAGCAGGAGGACATGGGG + Intronic
937126907 2:119480924-119480946 GCAAGGTGGGGGAGGCCTGGAGG - Intronic
938262231 2:129904153-129904175 GTAAGGTGCAGGAGGACGCCAGG + Intergenic
938639823 2:133266730-133266752 GGCAGGCGCAGGGGGACTGGCGG - Intronic
940790435 2:158025474-158025496 GCAGGGTACAGGAGGCCTTGAGG + Intronic
941007995 2:160267049-160267071 GTAAGTGGCAGGAGGACTTGTGG + Intronic
944800458 2:203233232-203233254 GGAAGGTTCAGCAGGACTTGGGG + Intergenic
946618018 2:221530557-221530579 GCAAGAAGTAGGGGGACTGGGGG + Intronic
947156042 2:227164132-227164154 GCAAGTTGGAGGCGGGCTGGAGG + Intergenic
948221197 2:236271000-236271022 GCAAGGACCAGGAGTATTGGGGG + Intergenic
948270444 2:236669669-236669691 CCAAGGTTCAGGGGGACTGCTGG - Intergenic
948619553 2:239225761-239225783 ACCAGGTGAGGGAGGACTGGAGG - Intronic
1168971420 20:1933539-1933561 GGAAGCTCCAGGAGGGCTGGAGG + Intronic
1168979494 20:1992663-1992685 GCAAGGTGTGGTGGGACTGGGGG + Intronic
1169080335 20:2794491-2794513 GGAAGGGGCTGGAGGGCTGGAGG - Intronic
1169781327 20:9313930-9313952 GGAAGGGGCAGCAGGGCTGGGGG + Intronic
1170859437 20:20089025-20089047 GCAGGGCGCAGGAGGAATGGTGG + Intronic
1171882056 20:30625028-30625050 CCAAAGTGAAGGAGTACTGGTGG - Intergenic
1173667159 20:44771240-44771262 GCAAGAACCAGGAGGGCTGGTGG + Intronic
1174370822 20:50086188-50086210 GCAAGGTTGAAGAGGAATGGTGG - Intronic
1176253956 20:64140849-64140871 GCAACGGGCATGAGGCCTGGAGG + Intergenic
1176366141 21:6034038-6034060 GGAGGCTGCAGGAGGACTGAGGG - Intergenic
1178906723 21:36642749-36642771 GCAAGGTGCAGGCAGAAGGGAGG + Intergenic
1179124575 21:38579548-38579570 ACAAGAAGCATGAGGACTGGAGG + Intronic
1179757376 21:43504507-43504529 GGAGGCTGCAGGAGGACTGAGGG + Intergenic
1180950257 22:19717617-19717639 GCAGGCTGCCGGAGTACTGGAGG - Intronic
1180992001 22:19942326-19942348 GAGAGTTGCAGGAGGCCTGGGGG + Intronic
1181025218 22:20123921-20123943 CCCAGGTGCAGGATGACTGCTGG + Intronic
1181514126 22:23401799-23401821 GCAAGGCGGGGGAGGAGTGGGGG + Intergenic
1181627376 22:24130986-24131008 GCTTGGTGCAGGTGGAGTGGTGG + Intronic
1181802198 22:25354929-25354951 GCAAGGTGCAGGTGAAGTTGAGG - Intronic
1181897193 22:26120697-26120719 ACCAGGTGCAGAAGGACTTGGGG - Intergenic
1182997336 22:34826258-34826280 GAAAGGTGCAGAAGGAAAGGAGG + Intergenic
1183177178 22:36232818-36232840 GCAGGGTCCAGGAGGAGGGGAGG - Intronic
1183180658 22:36257722-36257744 GCAGGGTCCAGGAGGAGAGGAGG + Intronic
1183225543 22:36547470-36547492 GAAAGGTGCATGAGGACTGGGGG + Intergenic
1183343357 22:37294166-37294188 GCAGGGTGGAGGTGGGCTGGGGG + Intronic
1183343394 22:37294253-37294275 GCAGGGTGGAGGTGGGCTGGGGG + Intronic
1183946189 22:41327134-41327156 GGCAGGGGCAGGAGGCCTGGGGG + Intronic
1184155507 22:42664142-42664164 GAAAGGCCCAGGAGGACAGGTGG - Intergenic
1184561951 22:45268636-45268658 GCGAGGGGCGGGAGGAATGGGGG - Intergenic
1184707257 22:46223228-46223250 GGGAGGTGCAGGAGGACTCCAGG - Intronic
1184984265 22:48118780-48118802 GCAAGGTGAACGGGGACTCGTGG - Intergenic
1185251889 22:49806635-49806657 GCAAGATGAAGGAGGCCTGGGGG + Intronic
1185302251 22:50088024-50088046 GCGAGCTGCATGAGGGCTGGTGG - Intergenic
1185310261 22:50150382-50150404 GCAAGGGGCAGGTGGGATGGCGG + Intronic
949827135 3:8177489-8177511 GCAAAGAACAGGAGGACAGGGGG - Intergenic
949959104 3:9297266-9297288 GCAAGGTGGAGGAGGACACTGGG - Intronic
951293314 3:20900766-20900788 GGAAGGAGAAGGAGAACTGGTGG + Intergenic
952920021 3:38277657-38277679 GAAAGGTGAAGGAGGCCGGGAGG - Exonic
953801876 3:46030980-46031002 GCAAGGTGCAGGTGGCGTGGTGG - Intergenic
955059540 3:55483636-55483658 GCCACGGGGAGGAGGACTGGGGG + Intronic
956954539 3:74321128-74321150 ACAAGAGGGAGGAGGACTGGGGG + Intronic
959461149 3:106627545-106627567 GGAAGGTGAAGAAGGGCTGGAGG + Intergenic
960672571 3:120167341-120167363 GCATGGGGCAGCAGGACTTGGGG + Exonic
961382513 3:126505082-126505104 GGAAGGTGAAGGGGGTCTGGTGG - Intronic
963247348 3:143075224-143075246 CCAAGGAGCAGCTGGACTGGGGG + Intergenic
964422582 3:156519760-156519782 GCCAGGAGCAGGAAAACTGGTGG + Intronic
966274763 3:178152361-178152383 GCAAGTGACAGGATGACTGGGGG - Intergenic
968462008 4:730886-730908 GCAAGTTCCAGTAGGAATGGCGG + Intronic
969723479 4:8906157-8906179 GCAAGGCTCAGGTGGTCTGGAGG + Intergenic
972714592 4:41632895-41632917 GGGAGGTGAAGGAGGACAGGTGG + Intronic
975478760 4:74854401-74854423 GCAGGTGGCAGGAGCACTGGAGG - Intergenic
975495800 4:75034910-75034932 GCACGGTCCAGGATGACTGAGGG - Intronic
977564769 4:98569507-98569529 GCAGAGTGCAGGATGGCTGGGGG + Intronic
978301189 4:107270696-107270718 GCAAGGAGCAGGTGGTGTGGTGG + Intronic
982092458 4:151892298-151892320 GGAAGGAGCAGGGGGAGTGGAGG + Intergenic
985469453 5:29882-29904 GCAAGAAGCATGAGGACTGATGG - Intergenic
985947905 5:3201007-3201029 CTTAGGTGCAGGAGGGCTGGAGG + Intergenic
986804301 5:11294082-11294104 TGAAGCTGCAGGAGCACTGGTGG + Intronic
990703903 5:58505777-58505799 GCATGGTGCATTAGGAATGGCGG - Intergenic
991989908 5:72327281-72327303 GAAAGGTATAGCAGGACTGGAGG - Intronic
994087299 5:95773361-95773383 GCAAGGAACAGCAGGAATGGTGG + Intronic
995190870 5:109318177-109318199 GCCAGTTACAGGATGACTGGTGG + Intergenic
995784656 5:115815885-115815907 GCCAGGGGCAGGAGGACTGGTGG + Intronic
996603414 5:125292970-125292992 GCAAGGTGAAAGAAGACTGGAGG + Intergenic
996993604 5:129667592-129667614 GCAAGGGGCAGGAGGGTGGGGGG - Intronic
997271848 5:132546315-132546337 GCAAGGTGCTGGGAGAATGGGGG - Intronic
998335866 5:141371750-141371772 GCACGGTGTAGGAGGCCTGGTGG - Exonic
999475069 5:151890879-151890901 ACAAGGTGCAGGGGGAGTGAAGG + Intronic
999892384 5:155993159-155993181 GCAAGAGGCAGAAGGACTGAAGG - Intronic
1000357994 5:160419187-160419209 CCACGGCGCAGGAGCACTGGAGG - Exonic
1001029380 5:168250734-168250756 GCACGGGGGAGGAGGACAGGAGG - Intronic
1001104872 5:168844289-168844311 GAATGCTGCAGGAGCACTGGGGG + Intronic
1002090642 5:176803539-176803561 GGAAGGGGCAGGAGGAGCGGAGG - Intergenic
1002497021 5:179622799-179622821 CCAAGGGCCAGGAGGACGGGCGG + Intronic
1002596926 5:180329813-180329835 GCAGGGTGCGGGAGGACGAGAGG - Intronic
1003260694 6:4512837-4512859 GCAAGGTGCAGGTACACAGGAGG + Intergenic
1003514135 6:6804314-6804336 GCAAGGGGCAGGAGGAGGGTAGG + Intergenic
1003618229 6:7674195-7674217 GAAATGTGCACGAGGTCTGGAGG + Intergenic
1004285166 6:14314889-14314911 GCACGGTGGAGAAGGACAGGGGG - Intergenic
1005724713 6:28637403-28637425 GCAAGATGCAGGGGGACAGAAGG + Intergenic
1006107871 6:31727571-31727593 CCACGGTGCAGGAGGAAAGGGGG + Exonic
1006478391 6:34272734-34272756 GCAGGGGGCTGGAGGACGGGAGG - Intergenic
1006854458 6:37123474-37123496 GCAGGGTGCAGGCGGATGGGGGG + Intergenic
1012309172 6:97700027-97700049 GCAAGTTGCTCTAGGACTGGAGG - Intergenic
1013317936 6:108959525-108959547 ACCAGGTGGAGAAGGACTGGGGG + Intronic
1014570170 6:122997669-122997691 GCAGGCAGCAGGAGGTCTGGGGG + Exonic
1015688718 6:135896225-135896247 GCAAGGTGGATTAGGGCTGGAGG + Intronic
1018953983 6:168395761-168395783 GACAGGTGCAGAAGGACTTGGGG + Intergenic
1019647220 7:2137513-2137535 GCAAGGTGCAGAAGGGAAGGAGG - Intronic
1020123275 7:5517755-5517777 GCAGGTGGCAGGAGGCCTGGAGG - Intergenic
1020141156 7:5612691-5612713 GCCAGATGCAGCAGAACTGGTGG + Intergenic
1021035456 7:15792841-15792863 GCAGGGTAGTGGAGGACTGGAGG + Intergenic
1021276889 7:18662978-18663000 GAAAGGAGCAGGAGCACTGATGG + Intronic
1021483618 7:21144755-21144777 GCATGGTCCAGCATGACTGGAGG - Intergenic
1022134832 7:27437315-27437337 GAAAAGTGCAGGATGACTTGGGG - Intergenic
1024527864 7:50363832-50363854 GCAAGGTGGAGGTGGATGGGAGG - Intronic
1025888156 7:65618792-65618814 GCCAGGTGCTTGAGTACTGGTGG + Intergenic
1029055129 7:97733141-97733163 GCGAGCTGCAGGGGGATTGGAGG + Intronic
1032080725 7:128857193-128857215 CCAAGGTGCAGCTGGACTGTCGG + Exonic
1032091529 7:128913967-128913989 CCAAGGTGCAGCTGGACTGTTGG - Intergenic
1032516593 7:132510677-132510699 GCAGGCTGCAGGAGGCCTTGGGG + Intronic
1033043474 7:137939562-137939584 GGAAGGGGCAAGAGGACTCGGGG - Intronic
1033659820 7:143395573-143395595 GAAAAGGGCCGGAGGACTGGAGG - Intronic
1034144436 7:148856131-148856153 GGAAGGAGCAGGAGGTCGGGGGG + Intronic
1034674637 7:152883771-152883793 GCTGGGTTCAGTAGGACTGGTGG - Intergenic
1034892734 7:154855070-154855092 TCAAGCTCCAGGAGAACTGGAGG + Intronic
1035214575 7:157355621-157355643 GGGAGCTGCAGCAGGACTGGGGG + Intronic
1035457145 7:159016005-159016027 GCAGGGGGCTGGAGGACTGCAGG - Intergenic
1036090603 8:5661065-5661087 AAAAGGTGCAGGTGGAATGGTGG + Intergenic
1036132973 8:6133522-6133544 GGGAGGTGAAGGAGGTCTGGAGG + Intergenic
1036214390 8:6866859-6866881 CCCAGGTGCAGGAGGACCAGAGG - Intergenic
1036815224 8:11897263-11897285 GCAGGGTGCAGGGGGGCGGGGGG + Intergenic
1039898739 8:41735403-41735425 GCCAGGAGGAGGAGGACAGGAGG - Intronic
1040806125 8:51398253-51398275 GCAAGGTGCAGCTGCACTCGAGG + Intronic
1041118670 8:54565217-54565239 GCAAGGTCCAGGAAGACAGATGG + Intergenic
1041854786 8:62438935-62438957 GCCAGGTGCAGGAGCAATGCTGG + Intronic
1042177163 8:66048151-66048173 GCAAGGGGCAGGAAGAGTGAGGG - Intronic
1044043662 8:87402080-87402102 GGAAGGTGAAGGAGGAATGAAGG + Intronic
1044191262 8:89320516-89320538 CCAAGGTGGAGGATGACTTGAGG - Intergenic
1045189924 8:99872173-99872195 GCAGGGTGCTGGAGGTCTGTGGG + Intronic
1045918558 8:107502687-107502709 GCAAGTGGGATGAGGACTGGAGG + Intergenic
1047928204 8:129701568-129701590 GCAAGGTTCAGCAGCAGTGGTGG - Intergenic
1048767495 8:137860826-137860848 ACAAGGTGCTGGAGGAAGGGAGG + Intergenic
1049623750 8:143611027-143611049 GCGAGGTGAAGGAGGATTGCTGG + Intergenic
1050463557 9:5897379-5897401 TCCAGGTGCTGGAGGCCTGGTGG + Intronic
1051524069 9:18022928-18022950 GCAAGGTGGAGAAGGATGGGAGG - Intergenic
1053277766 9:36796283-36796305 GCCAGGTGCAGGTGAGCTGGAGG + Intergenic
1054737514 9:68770384-68770406 GCAAGGTGCAGGAGGACTGGTGG - Intronic
1056438452 9:86596210-86596232 GTATGGAGCAGGTGGACTGGGGG + Intergenic
1056691696 9:88813469-88813491 TCAGGGTGCAGGAGGCCTGATGG - Intergenic
1057077265 9:92144572-92144594 GGAATGTGCAAGAGGACTTGCGG - Intergenic
1057796333 9:98160685-98160707 TCAAGGTGAGGGAGGAGTGGGGG - Intronic
1059978627 9:119744794-119744816 GCATTGTGCAGGGGGAGTGGAGG - Intergenic
1060319024 9:122538148-122538170 GGCAGGGGCAGGGGGACTGGGGG - Intergenic
1060768810 9:126315224-126315246 GCAGGGTGCAGGAGGATGAGAGG - Intergenic
1061473191 9:130843784-130843806 GCAAGCAACAGGAGGCCTGGGGG + Intronic
1061478723 9:130885860-130885882 GGAAGGTGCGGGAGGGCAGGCGG - Intronic
1061747745 9:132752748-132752770 GCCAGCTGCAGGAGGAGGGGAGG - Intronic
1062172471 9:135143027-135143049 GGAGTGTGCAGGAGGACTAGGGG + Intergenic
1062197407 9:135281868-135281890 GCAAGCTGCTGGAGGAGAGGGGG + Intergenic
1062200855 9:135301966-135301988 GGGAGGAGCAGGAGGCCTGGTGG - Intergenic
1186257755 X:7741193-7741215 TCAAGGTGCACCAGGACTGAAGG - Intergenic
1186429110 X:9489305-9489327 GAATGGTGGAGGAAGACTGGTGG + Intronic
1190220538 X:48509652-48509674 GCACGGTACTGGAGGACTGGGGG - Intronic
1190397519 X:50000003-50000025 GCATGGGGCAGGAGAGCTGGGGG - Intronic
1190474036 X:50810499-50810521 GTAAGGTGCAGGAAGCATGGTGG - Intronic
1192358651 X:70425085-70425107 GCAAGGTGGAGTAGGGATGGAGG + Exonic
1193035882 X:76950794-76950816 GCAAGGTGCAGCAAGGCTGGTGG + Intergenic
1194379716 X:93177593-93177615 AAATGGTGCAGCAGGACTGGTGG + Intergenic
1198767287 X:140092188-140092210 GCGAGGTGGAGGAGGAGCGGGGG - Intergenic
1199108527 X:143901883-143901905 GCAGGGGGAAGGAGGAATGGGGG + Intergenic
1199942706 X:152640631-152640653 ACAGGGTGCAGAAGGCCTGGGGG - Intronic
1200208297 X:154333281-154333303 GGGAGGTGCAGAGGGACTGGGGG + Intergenic