ID: 1054737515

View in Genome Browser
Species Human (GRCh38)
Location 9:68770387-68770409
Sequence CCAGCAAGGTGCAGGAGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 735
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 689}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054737515_1054737526 13 Left 1054737515 9:68770387-68770409 CCAGTCCTCCTGCACCTTGCTGG 0: 1
1: 0
2: 1
3: 44
4: 689
Right 1054737526 9:68770423-68770445 CAGGGTAAAAATAAGGATGAAGG No data
1054737515_1054737527 21 Left 1054737515 9:68770387-68770409 CCAGTCCTCCTGCACCTTGCTGG 0: 1
1: 0
2: 1
3: 44
4: 689
Right 1054737527 9:68770431-68770453 AAATAAGGATGAAGGAGAGAAGG No data
1054737515_1054737524 -5 Left 1054737515 9:68770387-68770409 CCAGTCCTCCTGCACCTTGCTGG 0: 1
1: 0
2: 1
3: 44
4: 689
Right 1054737524 9:68770405-68770427 GCTGGGGGTCTGACTTCTCAGGG No data
1054737515_1054737525 6 Left 1054737515 9:68770387-68770409 CCAGTCCTCCTGCACCTTGCTGG 0: 1
1: 0
2: 1
3: 44
4: 689
Right 1054737525 9:68770416-68770438 GACTTCTCAGGGTAAAAATAAGG No data
1054737515_1054737523 -6 Left 1054737515 9:68770387-68770409 CCAGTCCTCCTGCACCTTGCTGG 0: 1
1: 0
2: 1
3: 44
4: 689
Right 1054737523 9:68770404-68770426 TGCTGGGGGTCTGACTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054737515 Original CRISPR CCAGCAAGGTGCAGGAGGAC TGG (reversed) Intronic
900482347 1:2905330-2905352 CCACTCAGGTGCAGGAGGGCTGG + Intergenic
900960313 1:5914942-5914964 ACAGCTAGGCCCAGGAGGACAGG - Intronic
901259381 1:7860444-7860466 CCAGAAAGATGCAGAAGGGCAGG + Intergenic
901934443 1:12617982-12618004 CCAGCAACGTGCAGGAGAAGTGG + Intergenic
901947610 1:12716053-12716075 CCAGGGAGGTGGGGGAGGACAGG + Intergenic
902550233 1:17214937-17214959 CCAGGAAGAGGCAGGAGGAGGGG - Intronic
902635043 1:17729471-17729493 AGAGCAGGGTGCAGGAGGCCCGG - Intergenic
902918852 1:19654959-19654981 ACAGCAAGGTGCAGGGGGCCGGG - Intronic
903363837 1:22793878-22793900 CCAGCAAGCTGCAGAAAGCCAGG - Intronic
903931031 1:26862749-26862771 CCATAAAGGTTCAGGAGGATGGG - Intergenic
905060815 1:35137541-35137563 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
905276060 1:36819007-36819029 ACAGCAGGGAGCAGGAGGGCAGG - Intronic
906744839 1:48214339-48214361 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
907520982 1:55023219-55023241 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
907922977 1:58930219-58930241 CCAGAAAGGTCCAGGAGTCCTGG + Intergenic
908592348 1:65647530-65647552 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
909222921 1:72984968-72984990 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
909551281 1:76899904-76899926 GGAGCAAAATGCAGGAGGACAGG + Intronic
909667711 1:78154133-78154155 CCTCCAAGGTGCAGGAGGAGGGG - Intergenic
910049071 1:82955773-82955795 AGAGCAAAGAGCAGGAGGACGGG - Intergenic
910144153 1:84058845-84058867 GGAGCAAAGAGCAGGAGGACGGG + Intergenic
911148314 1:94572311-94572333 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
911966659 1:104380593-104380615 GGAGCAAAGTACAGGAGGACAGG - Intergenic
912813325 1:112810131-112810153 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
912815574 1:112825588-112825610 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
916328627 1:163591756-163591778 AGAGCAAAGAGCAGGAGGACAGG - Intergenic
917963665 1:180165480-180165502 TGAGCAAGGTGGAGGAGGAGAGG - Intronic
918133063 1:181645956-181645978 CCTGTGAGGTGCAGGAGGCCAGG + Intronic
918141857 1:181726542-181726564 CCAGCAAGGTTCAGTGTGACTGG + Intronic
918346701 1:183613692-183613714 GGAGCAAAGAGCAGGAGGACGGG - Intergenic
918534653 1:185560814-185560836 TCAGCAAGGTGGAGAAGGATGGG - Intergenic
918568010 1:185953691-185953713 GGAGCAAAGAGCAGGAGGACAGG + Intronic
918714691 1:187770693-187770715 AGAGCAAAGAGCAGGAGGACGGG + Intergenic
919476070 1:198035107-198035129 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
919818236 1:201455634-201455656 ACTGGAAGGTGCAGGAGGGCAGG - Intergenic
920440948 1:205980010-205980032 TCATCAAGGTGCAGGAGGCAAGG - Intronic
920844268 1:209580485-209580507 CCAGCAGGGTGCAGGTGAATTGG + Intergenic
920956802 1:210627085-210627107 CCATCAAGGTGCAGAGGGAAGGG - Intronic
921519856 1:216146102-216146124 AGAGCAAAGAGCAGGAGGACAGG - Intronic
921614840 1:217254034-217254056 CCAGCAGGGAGCATGAGCACTGG + Intergenic
921732528 1:218594111-218594133 GGAGCAAAGGGCAGGAGGACGGG - Intergenic
922048118 1:221966405-221966427 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
922154366 1:223029629-223029651 GGAGCAAAGAGCAGGAGGACGGG + Intergenic
923408940 1:233688658-233688680 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
923550472 1:234959187-234959209 CCAGGAGGGTGCAGAAGGACTGG + Intergenic
923771022 1:236937421-236937443 GGAGCAAAGAGCAGGAGGACGGG + Intergenic
923786056 1:237070653-237070675 CAAGCCAGGTGCAGGAGGCCAGG + Intronic
924730488 1:246707010-246707032 GCAGCCAGGGGCAGGAGGACTGG - Intergenic
924896318 1:248340625-248340647 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1062805646 10:417759-417781 CCTGACAGGTGCAGGTGGACAGG - Intronic
1062805674 10:417873-417895 CCTGACAGGTGCAGGTGGACAGG - Intronic
1062805693 10:417949-417971 CCTGACAGGTGCAGGTGGACAGG - Intronic
1062805703 10:417987-418009 CCTGACAGGTGCAGGTGGACAGG - Intronic
1062805745 10:418170-418192 CCTGACAGGTGCAGGTGGACAGG - Intronic
1062930521 10:1349471-1349493 AGAGCAAAGAGCAGGAGGACAGG - Intronic
1063017478 10:2093249-2093271 CCAGCAAGTTGCAGGAAACCAGG + Intergenic
1063362811 10:5471230-5471252 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1063703042 10:8404167-8404189 CCTGCAGGGGGCAGGAGGACAGG + Intergenic
1064319200 10:14286616-14286638 CCAGCAAGATGCAAGAGTCCTGG + Intronic
1064335317 10:14435375-14435397 AAAGGAAGCTGCAGGAGGACAGG - Intronic
1064664096 10:17631984-17632006 AGAGCAAAGAGCAGGAGGACAGG + Intergenic
1065307373 10:24381808-24381830 CCAGACAGGTGCAGCAGGGCTGG - Intronic
1065437337 10:25716884-25716906 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1065443473 10:25774363-25774385 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1065987851 10:30974196-30974218 CCAGCTAGGTGCAGGTGCTCAGG + Intronic
1066037552 10:31508639-31508661 CCACCAAGGGGCCTGAGGACAGG - Intronic
1067159265 10:43809359-43809381 CCAGCAAAGGGCAGCAGGTCAGG - Intergenic
1067288970 10:44927749-44927771 CTAGCAAGGTGCAAGAGAGCAGG - Intronic
1067360089 10:45571619-45571641 AGAGCAAAGAGCAGGAGGACAGG - Intronic
1067901995 10:50251461-50251483 CCAGCAACGTGCAAGGGGAAAGG - Intergenic
1068571789 10:58637910-58637932 CCAGTAAGGTACAGAAGGCCTGG + Intronic
1070474540 10:76818759-76818781 CAAGCAAAGAGCAGGAGGACAGG - Intergenic
1070490783 10:76974472-76974494 CGAGCCAGGTGAAGGAAGACTGG - Intronic
1070534067 10:77362134-77362156 CCAGCAGGCTGGAGGAGGGCAGG + Intronic
1070588188 10:77781826-77781848 CCAGCTACGTGCCCGAGGACGGG - Intergenic
1070741376 10:78905457-78905479 CCTCCATGGTGCAGGAGGCCCGG + Intergenic
1072011600 10:91306849-91306871 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1072419148 10:95274702-95274724 GCAGTAAGGTGCATGAGGGCAGG + Intronic
1072787282 10:98292926-98292948 CCAGCACAGTTCAGGAGTACAGG - Intergenic
1073311808 10:102548289-102548311 CCTGCAAAGTGCAGGAGGTCTGG + Intronic
1073683293 10:105728053-105728075 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1074144549 10:110705119-110705141 CCAGCATCGTGCTGGAGGCCGGG - Intronic
1074457566 10:113608820-113608842 CCATCAAGGTAGAGGAGCACTGG - Intronic
1075248434 10:120845450-120845472 GGAGCAAAGAGCAGGAGGACGGG - Intergenic
1076124150 10:127961471-127961493 CCAGCAAGATGCAACAGGACAGG + Intronic
1076702929 10:132283597-132283619 CCTGCAAGTTGCAGCAGGTCTGG + Intronic
1076734506 10:132452697-132452719 CCTGGCAGGTGCAGCAGGACGGG - Intergenic
1077162946 11:1121869-1121891 CTGGCAAGGCCCAGGAGGACGGG - Intergenic
1077611879 11:3648357-3648379 AGAGCAAAGAGCAGGAGGACAGG - Intronic
1077766703 11:5165633-5165655 GGAGCAAAGAGCAGGAGGACAGG + Intronic
1077883103 11:6366490-6366512 GGAGCAAAGTGCAGGAGGACAGG - Intergenic
1078570280 11:12452070-12452092 CCAGCAGGGTGCAGATGAACTGG + Intronic
1079355067 11:19723792-19723814 CCAGCATGTGGCAGGAGGACAGG - Intronic
1079447190 11:20568363-20568385 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1080227088 11:29973845-29973867 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1081356536 11:42121147-42121169 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1082197995 11:49326402-49326424 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1083628207 11:64082671-64082693 CCTGCAGGGTGGAGCAGGACAGG - Intronic
1083722513 11:64610396-64610418 CCAGCAAGGTGAGTGAGGCCGGG + Intronic
1083783369 11:64929887-64929909 ACTCCAAGGTGCAGGAGGACAGG - Intronic
1084201283 11:67560117-67560139 CCTGCAATGCCCAGGAGGACTGG + Intergenic
1084245854 11:67856539-67856561 AGAGCAAAGAGCAGGAGGACAGG + Intergenic
1084613594 11:70219683-70219705 AGAGCAAAGAGCAGGAGGACAGG + Intergenic
1085045402 11:73349819-73349841 TGAGCAAGGTGGAGGTGGACAGG + Intronic
1085934035 11:81122565-81122587 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1086004786 11:82025909-82025931 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1086132856 11:83419596-83419618 GCAGCAAAGAGCAGGAGGACAGG - Intergenic
1086657818 11:89381722-89381744 GGAGCAAAGAGCAGGAGGACAGG - Intronic
1087098810 11:94346174-94346196 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1087196593 11:95309939-95309961 GGAGCAAAGAGCAGGAGGACGGG - Intergenic
1087839845 11:102909428-102909450 AGAGCAAAGAGCAGGAGGACAGG + Intergenic
1088591384 11:111406643-111406665 CCAGAAATGAGCAGGAGGCCAGG + Intronic
1089432593 11:118436380-118436402 CCGGCAGGGTGCAGGCGGCCGGG + Intergenic
1089867328 11:121643037-121643059 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1089952958 11:122547076-122547098 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1089987094 11:122824881-122824903 AGAGCAAAGAGCAGGAGGACAGG - Intergenic
1090350137 11:126102737-126102759 CTAGCAAGGAGCAGGAGGCAGGG + Intergenic
1090527072 11:127547996-127548018 AGAGCAAAGAGCAGGAGGACAGG + Intergenic
1090847535 11:130543503-130543525 CCAGCAAGTTGTATGAGGAAAGG + Intergenic
1090850865 11:130569459-130569481 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1090927254 11:131259795-131259817 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1091183353 11:133627236-133627258 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1091742667 12:2971127-2971149 CCTGCAAGTTCCATGAGGACAGG - Intronic
1091940553 12:4476648-4476670 CCAGAGATGTGGAGGAGGACTGG - Intergenic
1091956188 12:4645535-4645557 CCATCTAGTTGCAGGAAGACAGG - Intronic
1092416437 12:8293669-8293691 AGAGCAAAGAGCAGGAGGACAGG + Intergenic
1092474173 12:8805332-8805354 AGAGCAAAGAGCAGGAGGACAGG - Intergenic
1092925108 12:13265047-13265069 AGAGCAAAGAGCAGGAGGACAGG + Intergenic
1093071448 12:14710086-14710108 AGAGCAAAGAGCAGGAGGACAGG + Intergenic
1093268290 12:17026862-17026884 AGAGCAAAGAGCAGGAGGACGGG + Intergenic
1093358287 12:18196209-18196231 GGAGCAAAGAGCAGGAGGACAGG - Intronic
1093578436 12:20763409-20763431 GGAGCAAAGAGCAGGAGGACGGG - Intergenic
1093584788 12:20822114-20822136 GGAGCAAAGAGCAGGAGGACGGG + Intronic
1094316360 12:29140281-29140303 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1094329421 12:29275003-29275025 GGAGCAAAGAGCAGGAGGACGGG - Intronic
1094723660 12:33090349-33090371 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1094825465 12:34266093-34266115 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1095637428 12:44450514-44450536 CGAGCAAAGAGCAGGAGGACAGG - Intergenic
1095704594 12:45222958-45222980 CCATAAAGGTCCAAGAGGACTGG + Intronic
1096558469 12:52418779-52418801 CCAGTCAGGCTCAGGAGGACAGG - Intergenic
1097398247 12:59102126-59102148 GGAGCAAAGAGCAGGAGGACGGG - Intergenic
1097417337 12:59328432-59328454 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1097542480 12:60957143-60957165 GAAGCAAAGAGCAGGAGGACAGG + Intergenic
1097592130 12:61587531-61587553 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1098167061 12:67709723-67709745 CCAGTAGAGTGCAGGAGGAGTGG - Intergenic
1099292401 12:80788415-80788437 GAAGCAAAGAGCAGGAGGACAGG + Intergenic
1099671874 12:85704744-85704766 TCAGAAAGGTGGGGGAGGACTGG - Intergenic
1099735126 12:86557505-86557527 CCACCATGGTGCCTGAGGACTGG + Intronic
1099836349 12:87912415-87912437 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1100940004 12:99715648-99715670 GGAGCAAAGAGCAGGAGGACAGG - Intronic
1101969226 12:109301128-109301150 CCGGCAGGGAACAGGAGGACAGG + Intronic
1102466726 12:113134750-113134772 CCAGCCAGGTGCAATGGGACTGG - Intronic
1102599932 12:114022018-114022040 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1102976138 12:117208302-117208324 CAAGGAAGGTGCTGGAGCACAGG + Exonic
1103324652 12:120112333-120112355 CCAGGCAGGAGCAGGAGGAAGGG - Intronic
1104000141 12:124855022-124855044 CCAGCAGGAGGCAGGAGGCCAGG + Intronic
1104133455 12:125916382-125916404 CAAGGCAGGTGGAGGAGGACGGG + Intergenic
1104431811 12:128722595-128722617 TCAACAAGGTGTAGGAGCACTGG - Intergenic
1104847547 12:131854240-131854262 CGAGGAAGGTGCAGGCGGACAGG - Intergenic
1106080177 13:26493843-26493865 CAAGCCAGGTACAGCAGGACAGG - Intergenic
1106721316 13:32437575-32437597 CCAGGTAGCTGGAGGAGGACTGG - Intronic
1106943182 13:34799407-34799429 GGAGCAAAGAGCAGGAGGACGGG - Intergenic
1107853863 13:44595738-44595760 CCCGCAAAGGGCAGGAGGAAAGG + Intergenic
1107934218 13:45331221-45331243 CCAGGGAGGAGGAGGAGGACTGG - Intergenic
1108202377 13:48056814-48056836 GGAGCAAAGAGCAGGAGGACAGG - Intronic
1108512696 13:51170365-51170387 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1108804110 13:54132688-54132710 GGAGCAAAGAGCAGGAGGACTGG + Intergenic
1109498991 13:63213599-63213621 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1110650807 13:77938907-77938929 AGAGCAAAGAGCAGGAGGACAGG + Intergenic
1110845028 13:80184010-80184032 AGAGCAAAGAGCAGGAGGACAGG - Intergenic
1111362405 13:87191627-87191649 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1112533790 13:100230215-100230237 CTAGCCAGGTGTGGGAGGACTGG + Intronic
1112889630 13:104213349-104213371 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1113323969 13:109265570-109265592 GGAGCAAAGAGCAGGAGGACGGG - Intergenic
1113376292 13:109767324-109767346 CCAGCAAGGAGAAGGAGGTGTGG + Intronic
1113764032 13:112869756-112869778 CCAGCAAGGTGCTGGAGGGCGGG - Intronic
1114271427 14:21102618-21102640 CCAGCATGCTGCAGGTAGACAGG - Exonic
1115240922 14:31250599-31250621 GGAGCAAAGAGCAGGAGGACGGG + Intergenic
1115931443 14:38500804-38500826 TCAGCCAGTTTCAGGAGGACTGG + Intergenic
1116535074 14:46017624-46017646 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1116573188 14:46544518-46544540 GGAGCAAAGAGCAGGAGGACGGG - Intergenic
1116613238 14:47104728-47104750 GGAGCAAAGAGCAGGAGGACAGG - Intronic
1116702659 14:48260468-48260490 AGAGCAAAGAGCAGGAGGACAGG + Intergenic
1116703615 14:48267799-48267821 AGAGCAAAGAGCAGGAGGACTGG + Intergenic
1117741563 14:58824225-58824247 CAAGCAAGGAGCAGCAGGGCAGG + Intergenic
1118937614 14:70301466-70301488 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1119316863 14:73703819-73703841 AGAGCAAAGAGCAGGAGGACGGG - Intergenic
1120618020 14:86732047-86732069 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1121289127 14:92760254-92760276 AGAGCAAAGAGCAGGAGGACAGG - Intergenic
1121525142 14:94614323-94614345 CTAGCAAGAGGCAGCAGGACAGG + Exonic
1122040711 14:98985735-98985757 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1122044057 14:99010952-99010974 GCAGCAAGGTGCTGGATGCCAGG - Intergenic
1122381592 14:101310776-101310798 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1122626082 14:103085972-103085994 CCACTAAGCTGCACGAGGACTGG - Intergenic
1122826514 14:104373508-104373530 CCAGGGAGGTGCAGGGGGTCAGG - Intergenic
1123098336 14:105776871-105776893 CCAGCAAGGAACAGGAAGAATGG + Intergenic
1123122197 14:105921870-105921892 CCCTCAAGGCGCAGCAGGACTGG - Intronic
1123404861 15:20013435-20013457 CCCTCAAGGCGCAGCAGGACTGG - Intergenic
1123514192 15:21020083-21020105 CCCTCAAGGCGCAGCAGGACTGG - Intergenic
1124620710 15:31272390-31272412 CCAGCATGGAGCAGGGGGAAAGG + Intergenic
1125045435 15:35239111-35239133 GGAGCAAAGAGCAGGAGGACGGG - Intronic
1125725966 15:41868308-41868330 CCAGCATGGCACAGTAGGACGGG + Intronic
1126347393 15:47710719-47710741 CCAAAAAGGTCCAGAAGGACTGG - Intronic
1126530431 15:49704272-49704294 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1126755754 15:51923445-51923467 CCAGCAAGGTTCTGAAGGACAGG - Intronic
1126843447 15:52739038-52739060 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1126912667 15:53431959-53431981 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1127115004 15:55717969-55717991 GGAGCAAAGAGCAGGAGGACAGG - Intronic
1127240882 15:57112567-57112589 CCAGCAAGGTGTAGATGGCCTGG + Intronic
1128074194 15:64816233-64816255 CCACTAGGGAGCAGGAGGACGGG + Intronic
1128417214 15:67457884-67457906 GCAGTAAGGTGGAGAAGGACAGG - Intronic
1129136318 15:73555402-73555424 TGAACAAGGTGCAGGAGGTCTGG - Intronic
1129190925 15:73937178-73937200 CCAGCATTGAGCAGGAGGACAGG + Intronic
1129259187 15:74354588-74354610 TGAGCAAAGAGCAGGAGGACAGG - Intronic
1129525106 15:76208729-76208751 CCAAAAGGGTGCAGGAGAACGGG - Intronic
1130060893 15:80569240-80569262 CCGGCGAGGTGCAGGAGTCCGGG - Intronic
1130304296 15:82702825-82702847 GAAGCAAAGAGCAGGAGGACAGG - Intronic
1130557106 15:84930355-84930377 CCAGCAAGGGGCAGGGGCCCAGG + Intronic
1131164622 15:90133536-90133558 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1131174689 15:90202146-90202168 CCAGCAAGTCGCAGCAGGGCCGG + Intronic
1131511581 15:93052077-93052099 CCTGCAAGGTGCAGGGCGCCTGG - Exonic
1131683889 15:94751211-94751233 GAAGCAAAGAGCAGGAGGACAGG - Intergenic
1132262698 15:100440658-100440680 AGAGCAAAGAGCAGGAGGACAGG - Intronic
1132632524 16:926743-926765 CCAGCACAGTGAAGGAGGAGAGG - Intronic
1133937846 16:10283601-10283623 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1133958305 16:10467205-10467227 CCACCAAGGTGAAGGAGCCCTGG - Intronic
1134342411 16:13357503-13357525 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1137055595 16:35745229-35745251 AGAGCAAAGAGCAGGAGGACAGG + Intergenic
1138558062 16:57784379-57784401 TCAGCAAGGGGCAGGTGGGCAGG + Intronic
1138582527 16:57950920-57950942 ACATCCAGGTGCAGGTGGACTGG + Intronic
1138759330 16:59522456-59522478 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1138846889 16:60577881-60577903 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1139039725 16:62985031-62985053 GGAGCAAAGGGCAGGAGGACAGG + Intergenic
1139944001 16:70625942-70625964 AGAGCAAAGAGCAGGAGGACAGG + Intronic
1140844238 16:78871457-78871479 CCACCCAGGTGCAGAAGCACTGG - Intronic
1141364849 16:83433159-83433181 CCAGTAAGTTCCAGGAAGACGGG - Intronic
1141796457 16:86278584-86278606 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1141917383 16:87108760-87108782 CCAGCTTGCTGCAGGAGGAGAGG + Intronic
1142143198 16:88481672-88481694 TCAGGAAAGTGCAGGGGGACAGG - Intronic
1142508318 17:379965-379987 CCAGCAGGGTGGAGGTAGACAGG + Intronic
1143884085 17:10053086-10053108 GCAGCAAGGTGGAGGAAGAGAGG + Intronic
1144312426 17:14025228-14025250 GCAGCGAGGTACAGGAGGCCAGG - Intergenic
1144332327 17:14236097-14236119 CCAGCGAGGTACAGGAGGCCAGG + Intronic
1144614501 17:16756989-16757011 CCATCAATGTGCCTGAGGACTGG - Intronic
1144898205 17:18558685-18558707 CCATCAATGTGCCTGAGGACTGG + Intergenic
1145134166 17:20387030-20387052 CCATCAATGTGCCTGAGGACCGG - Intergenic
1146428984 17:32773076-32773098 AGAGCAAAGAGCAGGAGGACAGG - Intronic
1146736215 17:35241597-35241619 CCAGGAAGGTGCAGGACAGCTGG + Intergenic
1146949399 17:36895165-36895187 TCAGGAAGGGGCAGGAGGAGAGG - Intergenic
1147793800 17:43028754-43028776 CCAGCCAGGATCAGGAGGTCAGG - Exonic
1148216232 17:45835340-45835362 CCAGTAAGGTTCTGGAGGCCTGG - Exonic
1148668242 17:49390700-49390722 CCAGCAAGGAGGAAGTGGACTGG + Intronic
1149371669 17:56000551-56000573 CCACAAAGGTGCATGAGGCCTGG + Intergenic
1150943422 17:69718518-69718540 TGAGCAAGGTGCAGGAAAACTGG - Intergenic
1151320307 17:73348832-73348854 CCAGGAAGGAGGAGGAGCACAGG - Intronic
1151518115 17:74610152-74610174 CTAGAGAGGTGGAGGAGGACCGG - Exonic
1151840016 17:76611012-76611034 ACAGCAAAGAGCAGGAGGATGGG + Intergenic
1152018704 17:77769181-77769203 CCAGCCAGGGGCAGCAGGGCTGG + Intergenic
1153627527 18:7035877-7035899 CCAGCAAGGAGCTGGTGGCCAGG - Intronic
1153821897 18:8839178-8839200 CCAGAGAGGGGCAGGAGGAGGGG + Intergenic
1155012320 18:21792179-21792201 ACAGCAAGGTGGAGGAGGAAGGG - Intronic
1155892974 18:31289454-31289476 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1156237114 18:35216461-35216483 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1156252169 18:35361311-35361333 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1156302002 18:35844553-35844575 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1156915593 18:42462277-42462299 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1156924323 18:42557620-42557642 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1157043714 18:44069413-44069435 TCAGGAAAGTGCAGGAAGACAGG - Intergenic
1157800038 18:50611761-50611783 TCAGCAAGATGCAGGAACACTGG + Intronic
1158005857 18:52671359-52671381 CCAGCAAGGTGAGGGAGCAGAGG - Intronic
1158336049 18:56415934-56415956 GGAGCAAAGAGCAGGAGGACGGG - Intergenic
1158394959 18:57071979-57072001 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1159900380 18:74039489-74039511 ACAGCCAGGAGCAGGAGGAAGGG - Intergenic
1159928999 18:74293240-74293262 AGAGCAAAGAGCAGGAGGACAGG - Intergenic
1160005258 18:75064273-75064295 CCAGCACGGTGTGGGAGTACAGG - Exonic
1160171922 18:76562383-76562405 CCAGCGCGGTGCAGAAGGGCTGG - Intergenic
1160798721 19:957297-957319 CCAGCAGGAGACAGGAGGACCGG + Intronic
1160939510 19:1613793-1613815 CCAGCCAGGGGCAGGAGCTCAGG - Intronic
1161435070 19:4258234-4258256 CCCGCCAGGTGCTGGAGAACCGG + Exonic
1161447595 19:4327208-4327230 CCAGGGAGGTGCAAGAGAACTGG + Exonic
1161634234 19:5377215-5377237 CAGGGAAGGGGCAGGAGGACAGG + Intergenic
1161661438 19:5549065-5549087 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1161684490 19:5696180-5696202 GCGGCAAGGTGCTGGGGGACTGG + Intronic
1162520914 19:11178839-11178861 CCTCCAAGGGGCAGGAAGACTGG - Intronic
1162533035 19:11246812-11246834 CCAGCAAGGTGGAGTAAGACAGG - Intronic
1162754153 19:12847286-12847308 CCTGGGAGGAGCAGGAGGACTGG - Exonic
1163293850 19:16399194-16399216 CCAGCAGGATTCAGGAGGTCAGG + Intronic
1163368405 19:16888910-16888932 CCAGCAAGATGCAGGGGGGGGGG - Exonic
1163696876 19:18768638-18768660 CCACCAGGGGGCAGGCGGACGGG - Exonic
1164459559 19:28435279-28435301 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1164690922 19:30210271-30210293 CCAGCAAGAGGCTGGAGGGCCGG - Intergenic
1164713191 19:30373893-30373915 TCAGCAAGGTGCACGCGGCCCGG + Intronic
1164749564 19:30642474-30642496 CCCGCAAGTTGAAGGAGGAATGG + Intronic
1164771420 19:30812270-30812292 CCCACAAGGTGAAGCAGGACTGG + Intergenic
1165248963 19:34514545-34514567 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1165497277 19:36160507-36160529 GGAGCAAAGAGCAGGAGGACGGG + Intergenic
1165963841 19:39557882-39557904 CAAGAAAGCTGCAGGAGGAAGGG - Intergenic
1166656665 19:44617168-44617190 CCCGCAAAGTGCAGGATTACAGG + Intronic
1166679850 19:44759535-44759557 CCAGCAAAGGGCAGGAAGGCGGG - Exonic
1166751147 19:45164506-45164528 CCAGGAAGATGCAGAAGGGCAGG + Intronic
1166980868 19:46631298-46631320 CCAGGAATGTGAAGGAGGAAGGG + Intergenic
1167132841 19:47598791-47598813 CCCGCAAAGTGCAGGATTACAGG + Intergenic
1167147811 19:47693704-47693726 CCAGCAGGAGGCAGGAGGGCCGG - Intronic
1167620014 19:50555507-50555529 CATGAAAGGGGCAGGAGGACAGG + Intronic
1168051327 19:53831905-53831927 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1168212410 19:54900112-54900134 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
925491838 2:4403733-4403755 CCTGGAAGATGCAAGAGGACAGG - Intergenic
926464373 2:13169191-13169213 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
926605481 2:14894327-14894349 CCAGAATGGAGCAGGAGTACAGG + Intergenic
927936282 2:27078577-27078599 CCAGCAGGGAGGAGGAGGCCAGG + Exonic
928928268 2:36599577-36599599 GGAGCAAAGAGCAGGAGGACAGG - Intronic
929793376 2:45039686-45039708 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
930019783 2:46994525-46994547 CTGGCAAGGTGCAGCAGGGCAGG - Intronic
930055710 2:47250599-47250621 CTAGCAGGCTGCAGGAGGATGGG + Intergenic
930487599 2:52027114-52027136 AGAGCAAAGAGCAGGAGGACAGG + Intergenic
930954703 2:57192782-57192804 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
930954817 2:57193545-57193567 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
931026692 2:58118627-58118649 GGAGCAAAGAGCAGGAGGACAGG + Intronic
931236582 2:60417884-60417906 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
931625461 2:64252946-64252968 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
931850122 2:66244387-66244409 AGAGCAAAGAGCAGGAGGACAGG - Intergenic
932112656 2:69014452-69014474 CCAGGGAGGTGCAGGAGCCCTGG + Intronic
932585535 2:73025754-73025776 CCAGGAAGGTGCAGGCGGCATGG + Intronic
933012766 2:77088725-77088747 GGAGCAAAGAGCAGGAGGACGGG - Intronic
933180103 2:79217236-79217258 GGAGCAAAGAGCAGGAGGACAGG + Intronic
933329826 2:80879723-80879745 GGAGCAAAGAGCAGGAGGACGGG + Intergenic
935670863 2:105556239-105556261 ACAGGAAGGGGCATGAGGACTGG + Intergenic
936111255 2:109667234-109667256 CAGGCAAGGTGCTGAAGGACAGG + Intergenic
936794517 2:116189227-116189249 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
936883053 2:117279254-117279276 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
936996518 2:118420338-118420360 CTTGCATGGTGCAGGAGTACAGG + Intergenic
938109655 2:128555314-128555336 CCAGCATTATGCAGGAGGACAGG + Intergenic
938408406 2:131045289-131045311 CCAGGAAGGTGCAGGTGTGCAGG + Intronic
939460970 2:142494872-142494894 AGAGCAAAGAGCAGGAGGACAGG + Intergenic
939851820 2:147313560-147313582 CCTGCAAGCTGTAGGGGGACAGG + Intergenic
940182711 2:150953789-150953811 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
940704977 2:157093350-157093372 CCTGCAATGTGTAGGAAGACAGG - Intergenic
941936187 2:170982913-170982935 AGAGCAAAGAGCAGGAGGACAGG + Intergenic
942730548 2:179056859-179056881 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
942791748 2:179768768-179768790 CCAGCAATGTGGAAGAGGAGGGG + Intronic
943061318 2:183044530-183044552 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
943834863 2:192506541-192506563 AGAGCAAAGAGCAGGAGGACAGG - Intergenic
943865117 2:192918772-192918794 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
943951572 2:194136072-194136094 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
944250794 2:197578825-197578847 GGAGCAAAGAGCAGGAGGACAGG - Intronic
944387150 2:199179865-199179887 CGAGCAAAGAACAGGAGGACAGG - Intergenic
944689845 2:202149097-202149119 CTAGCAGGGGGCGGGAGGACAGG + Intronic
945173152 2:207017678-207017700 ACGGCAAAGAGCAGGAGGACAGG - Intergenic
945360833 2:208894217-208894239 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
945394042 2:209299841-209299863 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
945769805 2:214029260-214029282 CAAGCAAGGAGCAGCAGGAGTGG + Intronic
946001414 2:216485628-216485650 CCAGCAGGGAGCAGGGGGAAGGG - Intergenic
946023757 2:216659513-216659535 CCAGCAAGCTCCAGAAGGGCAGG - Intronic
946215360 2:218179385-218179407 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
946781331 2:223195029-223195051 GGAGCAAAGAGCAGGAGGACAGG + Intronic
948222138 2:236279018-236279040 CCAGCAAGCTCCATGGGGACTGG + Intergenic
948771257 2:240252326-240252348 CCAGCACGATGCAGAAGGGCTGG + Intergenic
948922582 2:241072672-241072694 CCAGCAAGGTGTCTGAGGAGAGG + Intronic
1168739121 20:173275-173297 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1168943560 20:1733067-1733089 AGAGCAAAGAGCAGGAGGACAGG + Intergenic
1170165582 20:13358381-13358403 GGAGCAAAGAGCAGGAGGACGGG - Intergenic
1170325782 20:15153079-15153101 GGAGCAAAGAGCAGGAGGACAGG + Intronic
1170671727 20:18440551-18440573 CCAGCATGCTACAGGAGGACAGG - Intronic
1170820983 20:19756275-19756297 AGAGCAAAGAGCAGGAGGACAGG + Intergenic
1170859436 20:20089022-20089044 CCTGCAGGGCGCAGGAGGAATGG + Intronic
1171880209 20:30613042-30613064 CCAGCAATGAGCAGGAACACAGG + Intergenic
1172804141 20:37599004-37599026 CAAGCAAGTTGCAGAATGACAGG - Intergenic
1172809147 20:37634552-37634574 CCAGCAACGTGCAGAAAGAGGGG - Intergenic
1173177242 20:40773612-40773634 CCAGCAACGTGGAAGAAGACAGG + Intergenic
1173781345 20:45759802-45759824 GGAGCAAAGAGCAGGAGGACAGG - Intronic
1175176355 20:57114791-57114813 GGAGCCAGGTGCAGGAGGTCAGG + Intergenic
1175220595 20:57414391-57414413 CCAACAAGGGGCAGCAGGAGGGG + Intergenic
1175764299 20:61582161-61582183 CCAGGGAGGGGCAGGTGGACAGG - Intronic
1175881941 20:62264432-62264454 CCAGCACGGTACAGGAGGCACGG - Intronic
1176228176 20:64015533-64015555 GCAACAGGGTGCAGGAGCACAGG - Intronic
1177031416 21:15984830-15984852 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1177100334 21:16892662-16892684 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1177102422 21:16914579-16914601 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1177119266 21:17121942-17121964 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1177840966 21:26233005-26233027 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1178096050 21:29217019-29217041 CCAGGAAGTAGAAGGAGGACCGG + Intronic
1178164194 21:29953561-29953583 CCAGCAAGGTAGAAGAGGCCTGG - Intergenic
1178495065 21:33079266-33079288 CCGGCAAGGTGCTGGGGGCCAGG + Intergenic
1178518328 21:33266782-33266804 GCAGAGAGCTGCAGGAGGACAGG - Intronic
1179015535 21:37592024-37592046 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1179314109 21:40225835-40225857 CCAAGAAGGTGTTGGAGGACAGG - Intronic
1179496130 21:41772390-41772412 CCAGCTTGGTGCTGCAGGACCGG + Intergenic
1180048218 21:45319473-45319495 CCAGCAAGGTGCAGTAGAAAAGG + Intergenic
1180055412 21:45356477-45356499 CCACCAAGGTCCAAAAGGACAGG + Intergenic
1180138158 21:45874855-45874877 GCAGCAAGGAGCAGCAGCACAGG - Intronic
1180157202 21:45983475-45983497 TCAGCAGGGTCAAGGAGGACGGG - Intronic
1180560607 22:16611796-16611818 GGAGCAAAGAGCAGGAGGACGGG - Intergenic
1180706945 22:17816000-17816022 CCAGCCAGGAGGAGGAGCACAGG + Intronic
1181302304 22:21889438-21889460 CCAGCAAGCTGCACCAGGAATGG - Intergenic
1181521776 22:23452463-23452485 GAAGCAAGGTGCATGAGGATGGG - Intergenic
1181711758 22:24695760-24695782 CAAGAATGGTGCAGGAGGGCCGG - Intergenic
1181964758 22:26648467-26648489 ACAGCAAGGCTCAGGAGGCCAGG - Intergenic
1182074235 22:27484029-27484051 CCAGGAAGGAGCAGGGGGACAGG - Intergenic
1182113650 22:27742483-27742505 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1183225540 22:36547467-36547489 AAAGAAAGGTGCATGAGGACTGG + Intergenic
1184551914 22:45209158-45209180 CCTGCTAGGTGCAGGAGGCCCGG + Intronic
1185026814 22:48418980-48419002 CCAGCAAGCTCCCTGAGGACTGG + Intergenic
949285634 3:2400513-2400535 CCACCAAGTGGCAGGAGGAAGGG - Intronic
950084733 3:10249173-10249195 CCTGCAAGGTACAGGGGGCCTGG - Exonic
950503268 3:13377604-13377626 GCAGCAGGGTGGAGGAGGATGGG + Intronic
950926186 3:16744731-16744753 AGAGCAAAGAGCAGGAGGACAGG - Intergenic
951763048 3:26165401-26165423 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
952343804 3:32466437-32466459 GGAGCAAAGAGCAGGAGGACAGG + Intronic
953077450 3:39583136-39583158 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
953366677 3:42351304-42351326 CCAGCAGGGAGGAGGAGGGCAGG + Intergenic
954162036 3:48729730-48729752 GGAGCAAAGAGCAGGAGGACAGG + Intronic
954969555 3:54639680-54639702 GGAGCAAAGAGCAGGAGGACAGG + Intronic
955253109 3:57304313-57304335 CGAGCAAAGAGCAGGAGGACAGG - Intronic
955977047 3:64489528-64489550 CCGGCAAGGAGCAGGAGTGCAGG + Intergenic
956549227 3:70439932-70439954 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
956708948 3:72023583-72023605 AGAGCAAAGAGCAGGAGGACAGG - Intergenic
957060177 3:75475262-75475284 AGAGCAAAGAGCAGGAGGACAGG + Intergenic
957735136 3:84192966-84192988 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
958800040 3:98744624-98744646 CAGGCAAGGTGCAGAAGGGCAGG - Intronic
959038032 3:101387671-101387693 CCATCAGGGAGCATGAGGACAGG + Intronic
959288661 3:104445270-104445292 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
959486050 3:106927910-106927932 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
959972564 3:112422841-112422863 GGAGCAAAGAGCAGGAGGACGGG + Intergenic
960121777 3:113954296-113954318 CCACCAAAGCGAAGGAGGACTGG + Exonic
961141741 3:124562066-124562088 CCAGCATGGAGCATGAGGGCTGG + Intronic
961293208 3:125864145-125864167 AGAGCAAAGAGCAGGAGGACAGG - Intergenic
961521034 3:127467472-127467494 CAGGCAAGCTGCAGGAGGAAGGG - Intergenic
961730291 3:128960300-128960322 GGAGCAAAGAGCAGGAGGACGGG - Intronic
961781925 3:129325465-129325487 GCAGCAGGGTGGAGGAGGATGGG + Intergenic
961893977 3:130152268-130152290 ACAGCAAAGAGCAGGAGGACAGG + Intergenic
962022406 3:131514092-131514114 AGAGCAAAGAGCAGGAGGACAGG + Intergenic
962286732 3:134092569-134092591 CCAGGAAGGAGGAGGAGGCCAGG + Intronic
962660378 3:137596099-137596121 AGAGCAAAGAGCAGGAGGACAGG - Intergenic
962872182 3:139506977-139506999 CCAGCAAGCTCCTGGAGCACTGG + Intergenic
963112076 3:141696232-141696254 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
963319500 3:143797989-143798011 GGAGCAAAGAGCAGGAGGACAGG - Intronic
963456974 3:145556440-145556462 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
963468333 3:145710897-145710919 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
963684015 3:148414745-148414767 AGAGCAAAGAGCAGGAGGACAGG - Intergenic
964067519 3:152597475-152597497 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
964125788 3:153232038-153232060 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
964924288 3:161937212-161937234 CCAGCAAGGATCAAGGGGACTGG - Intergenic
965070034 3:163907986-163908008 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
965262924 3:166505947-166505969 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
965287008 3:166829226-166829248 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
965334815 3:167422894-167422916 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
965336056 3:167431737-167431759 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
965537368 3:169837072-169837094 CCAGTAAGGAGCAGGAAGGCAGG + Intronic
965626643 3:170688734-170688756 GGAGCAAAGAGCAGGAGGACAGG + Intronic
966066502 3:175827985-175828007 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
966105378 3:176326840-176326862 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
966233052 3:177670608-177670630 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
966397412 3:179517531-179517553 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
967092096 3:186143531-186143553 CCAGCAAAGGGAAGGAGCACTGG - Intronic
967244464 3:187471521-187471543 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
967644125 3:191900629-191900651 AGAGCAAAGAGCAGGAGGACAGG + Intergenic
967843100 3:194022829-194022851 CCAGCAACATTCAGGAAGACGGG - Intergenic
968382381 4:107722-107744 GCCGCAAGGTGCAGGCGGCCCGG + Intergenic
968503337 4:961103-961125 CCACCCCGGTGCAGGTGGACGGG - Exonic
968996021 4:3946405-3946427 CCAGCAGGATGCTGGAGCACAGG - Intergenic
969004070 4:4005339-4005361 AGAGCAAAGAGCAGGAGGACAGG + Intergenic
969100661 4:4765861-4765883 CCATCAGGCTGCAGGAAGACAGG + Intergenic
969299671 4:6290608-6290630 CAAGCAGAGGGCAGGAGGACTGG - Intronic
969307980 4:6336500-6336522 TCAGGAAGGGGCAGGAGGAGGGG + Intronic
969451745 4:7277771-7277793 CCAGCGCTCTGCAGGAGGACGGG - Intronic
969654433 4:8488189-8488211 GGAGCAAAGAGCAGGAGGACAGG + Intronic
970087291 4:12364317-12364339 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
971199825 4:24501476-24501498 GGAGCAAAGAGCAGGAGGACGGG - Intergenic
971552524 4:27975352-27975374 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
972045773 4:34663589-34663611 CCAGCATGGTGCTTGAGGCCAGG + Intergenic
972586186 4:40438741-40438763 ACAGCATGGTGCAAGAGAACGGG - Exonic
972714590 4:41632892-41632914 CCCGGGAGGTGAAGGAGGACAGG + Intronic
972799945 4:42463552-42463574 ACAGCAAGTTCCTGGAGGACAGG + Intronic
973289941 4:48461149-48461171 CCACCTAGGTGCAAGAGGCCTGG - Intergenic
973544904 4:51971765-51971787 CCAGCTAGCATCAGGAGGACAGG - Intergenic
974428680 4:61769470-61769492 GGAGCAAAGAGCAGGAGGACAGG + Intronic
974644106 4:64670912-64670934 CAAGCCAGCTGCAGCAGGACAGG + Intergenic
974953787 4:68614642-68614664 CCAGCAAGGAGCTGAAGCACAGG - Intronic
976273288 4:83251222-83251244 TCAGCAAGTTCCAGTAGGACAGG - Intergenic
976558325 4:86475278-86475300 GGAGCAAAGAGCAGGAGGACAGG - Intronic
976696233 4:87922303-87922325 CGAGCAAAGAACAGGAGGACAGG - Intergenic
977041709 4:92026291-92026313 GGAGCAAAGAGCAGGAGGACGGG - Intergenic
977217445 4:94298393-94298415 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
977225656 4:94388795-94388817 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
977446665 4:97139580-97139602 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
977782743 4:100997006-100997028 GGAGCAAGGAGCAGGAGGACAGG + Intergenic
978001412 4:103558970-103558992 AGAGCAAAGTGTAGGAGGACGGG + Intergenic
978031219 4:103941774-103941796 AGAGCAAAGAGCAGGAGGACAGG - Intergenic
978194460 4:105954632-105954654 GCAAGAAGGTGCAGGAGGAAGGG - Intronic
978405087 4:108370882-108370904 GCAGCAAGATGCAGGGGGAATGG - Intergenic
979895405 4:126150043-126150065 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
980003637 4:127516681-127516703 AGAGCAAAGAGCAGGAGGACAGG + Intergenic
980112241 4:128646127-128646149 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
980284675 4:130767861-130767883 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
980527592 4:134012671-134012693 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
980575926 4:134683073-134683095 AGAGCAAAGAGCAGGAGGACGGG + Intergenic
981524838 4:145699322-145699344 AGAGCAAAGAGCAGGAGGACAGG - Intronic
982180794 4:152746636-152746658 GGAGCAAAGAGCAGGAGGACAGG + Intronic
982414494 4:155113714-155113736 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
982497427 4:156108824-156108846 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
983023577 4:162709634-162709656 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
983055199 4:163093653-163093675 GGAGCAAAGAGCAGGAGGACGGG - Intergenic
983345305 4:166521149-166521171 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
983447772 4:167876759-167876781 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
983452033 4:167923366-167923388 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
983707418 4:170678095-170678117 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
984165610 4:176299928-176299950 GCAGCAAAGAGCAGGAGGACAGG + Intergenic
984393891 4:179170047-179170069 AGAGCAAAGAGCAGGAGGACAGG + Intergenic
985558812 5:571117-571139 CCAGCCTGGGGCAGGAGGCCGGG + Intergenic
985581971 5:702950-702972 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
985658471 5:1143981-1144003 CCAGCCAGGGGTAGGAGGGCAGG - Intergenic
986162249 5:5240603-5240625 ACAGCAAGGTGTAGGTGGATGGG - Intronic
986193237 5:5516023-5516045 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
986369221 5:7063262-7063284 AGAGCAAAGAGCAGGAGGACAGG + Intergenic
986905489 5:12490371-12490393 GGAGCAAAGAGCAGGAGGACGGG - Intergenic
986988118 5:13522100-13522122 CCAGCACGCTGCAGGAGGGCTGG - Intergenic
987281730 5:16420429-16420451 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
987755491 5:22095112-22095134 GGAGCAAAGAGCAGGAGGACAGG - Intronic
988279117 5:29122685-29122707 CCAGCAACCTGCAGAAGAACTGG - Intergenic
989204032 5:38793845-38793867 TCAGCAGTGTGCAGGAGGAGAGG - Intergenic
989659703 5:43786909-43786931 TGAGCAAAGAGCAGGAGGACAGG - Intergenic
990547931 5:56842289-56842311 ACAGCATAGTGGAGGAGGACAGG + Intronic
992049789 5:72931686-72931708 CCAGAAAGGTGAAGGAGAAAAGG + Intergenic
994126351 5:96171873-96171895 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
994775406 5:104032169-104032191 GGAGCAAAGAGCAGGAGGACCGG - Intergenic
995296587 5:110531382-110531404 AGAGCAAAGAGCAGGAGGACAGG - Intronic
995402817 5:111760659-111760681 TCAGCAAGTTGAAGGAGGAAAGG + Intronic
996052899 5:118952197-118952219 GGAGCAAAGAGCAGGAGGACAGG + Intronic
996345076 5:122478661-122478683 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
996358859 5:122623850-122623872 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
996575274 5:124971754-124971776 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
997741783 5:136261397-136261419 ACAGCACAGTGCAGGTGGACTGG - Intronic
997788679 5:136737483-136737505 AGAGCAAAGAGCAGGAGGACAGG - Intergenic
998996664 5:147874005-147874027 GGAGCAAAGAGCAGGAGGACAGG + Intronic
999047193 5:148482174-148482196 CCCCCAAGGTGCAGGAGGGCAGG - Exonic
999739393 5:154538597-154538619 CCAGCTTGGAGCAGGAGGCCAGG - Intergenic
999801985 5:155046836-155046858 CCTGCCAGGTGCAGGAGAGCAGG - Intergenic
1000438282 5:161240426-161240448 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1000439413 5:161248870-161248892 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1000519724 5:162280678-162280700 CGAGCAAAGAGCAGGAGGACAGG + Intergenic
1000606692 5:163334782-163334804 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1000859326 5:166437841-166437863 AGAGCAGGGTGGAGGAGGACTGG - Intergenic
1000885589 5:166744178-166744200 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1000935958 5:167303198-167303220 GGAGCAAAGAGCAGGAGGACAGG + Intronic
1001314004 5:170630003-170630025 CCAGCCTGGTGCAGGGAGACGGG - Intronic
1001331789 5:170767383-170767405 GGAGCAAAGAGCAGGAGGACAGG + Intronic
1002090643 5:176803542-176803564 TCAGGAAGGGGCAGGAGGAGCGG - Intergenic
1002132632 5:177090926-177090948 CCAGTAGGGTGCTGGAGGGCAGG - Exonic
1002367253 5:178723238-178723260 CCAGCAAGGAGCTGCAGGGCAGG - Intronic
1002497017 5:179622796-179622818 CCCCCAAGGGCCAGGAGGACGGG + Intronic
1002611274 5:180420000-180420022 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1002841007 6:907273-907295 CCAGCGGGGAGCAGCAGGACGGG - Intergenic
1002850888 6:995513-995535 CCAGGGAGGAGGAGGAGGACGGG + Intergenic
1003071297 6:2947481-2947503 CCATCCAGGAGCAGAAGGACAGG - Intergenic
1004105903 6:12667631-12667653 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1004836735 6:19539486-19539508 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1006107867 6:31727568-31727590 CCTCCACGGTGCAGGAGGAAAGG + Exonic
1006478392 6:34272737-34272759 CCTGCAGGGGGCTGGAGGACGGG - Intergenic
1006650171 6:35544960-35544982 GCAGGAGGGTGGAGGAGGACTGG + Intergenic
1006854455 6:37123471-37123493 CCAGCAGGGTGCAGGCGGATGGG + Intergenic
1007956296 6:45920769-45920791 CCAGCAGGGCCCAGGAGGATTGG + Intronic
1008540816 6:52545309-52545331 GGAGCAAGGTCCAGGAGGCCAGG + Intronic
1008850587 6:56016315-56016337 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1009343321 6:62586431-62586453 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1009359090 6:62792076-62792098 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1009378893 6:63005932-63005954 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1009464118 6:63950642-63950664 GGAGCAAAGAGCAGGAGGACAGG - Intronic
1010071968 6:71753589-71753611 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1010827207 6:80487636-80487658 GGAGCAAAGAGCAGGAGGACGGG + Intergenic
1010829919 6:80515320-80515342 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1010841575 6:80652910-80652932 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1010894892 6:81350656-81350678 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1013408203 6:109861095-109861117 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1013667873 6:112366699-112366721 CCAGCCAGGAGCAGGACGCCGGG - Intergenic
1013796659 6:113896247-113896269 CCAGCATGATGCAGGAGGGCTGG - Intergenic
1013891382 6:115032294-115032316 GGAGCAAAGAGCAGGAGGACGGG - Intergenic
1014395701 6:120925285-120925307 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1014718312 6:124890889-124890911 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1014891268 6:126849325-126849347 GGAGCAAAGAGCAGGAGGACGGG - Intergenic
1015164910 6:130192761-130192783 GGAGCAAAGAGCAGGAGGACAGG - Intronic
1016114429 6:140262597-140262619 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1016204243 6:141453275-141453297 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1016536043 6:145108386-145108408 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1016650663 6:146455965-146455987 AGAGCAAAGAGCAGGAGGACGGG + Intergenic
1017779652 6:157706014-157706036 GGAGCAAAGAGCAGGAGGACAGG + Intronic
1018077338 6:160229100-160229122 AGAGCAAAGAGCAGGAGGACAGG - Intronic
1018084812 6:160291840-160291862 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1018177933 6:161194975-161194997 CAAGTAAGGTGCAGGAAGGCAGG - Intronic
1018495771 6:164344299-164344321 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1018632914 6:165835765-165835787 CCAGCAGCGTACAGGAGGAGGGG + Intronic
1020324210 7:6961840-6961862 AGAGCAAAGAGCAGGAGGACAGG + Intergenic
1021145544 7:17084263-17084285 TCAGCAACGGACAGGAGGACAGG - Intergenic
1021500935 7:21330674-21330696 CAGGCAAGGTGCAGGTGGCCCGG + Intergenic
1021637031 7:22703837-22703859 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1021810362 7:24396748-24396770 AGAGCAAAGAGCAGGAGGACAGG - Intergenic
1022372595 7:29785440-29785462 GGAGCAAAGAGCAGGAGGACGGG - Intergenic
1022572998 7:31471904-31471926 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1023515487 7:40997313-40997335 CCAGCAAGGTGAGGGATGGCAGG - Intergenic
1023699192 7:42875851-42875873 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1024394487 7:48849909-48849931 CCAGACAATTGCAGGAGGACTGG - Intergenic
1024400779 7:48922732-48922754 CCAGACAATTGCAGGAGGACTGG + Intergenic
1024527865 7:50363835-50363857 ACAGCAAGGTGGAGGTGGATGGG - Intronic
1024697293 7:51870381-51870403 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1026895690 7:74008758-74008780 TCAGGAAAGTGCAGGAGGTCAGG - Intergenic
1026982661 7:74535909-74535931 AGAGCAAGGGGCAGGAGGAATGG - Intronic
1028596654 7:92553304-92553326 ACAGCAAGGTTCAAGAGGATAGG + Intergenic
1028689890 7:93640395-93640417 GGAGCAAAGAGCAGGAGGACAGG - Intronic
1029307457 7:99630620-99630642 CCAGCACGGGGCAGGAGGGCAGG - Exonic
1029499940 7:100922720-100922742 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1030441947 7:109597116-109597138 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1030751801 7:113238767-113238789 GGAGCAAAGAGCAGGAGGACGGG + Intergenic
1031004396 7:116456114-116456136 GGAGCAAAGAGCAGGAGGACAGG - Intronic
1031296386 7:120009680-120009702 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1031355511 7:120782413-120782435 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1031365042 7:120890911-120890933 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1031462402 7:122067789-122067811 CCAGCAGGGTCCAAGAGGGCAGG - Intergenic
1031728222 7:125264118-125264140 GGAGCAAAGAGCAGGAGGACGGG + Intergenic
1032783988 7:135186308-135186330 CCACCCAGCTGCAAGAGGACAGG + Exonic
1033049059 7:137987798-137987820 CCAGCTACTTGCAGGAGGCCGGG - Intronic
1033465325 7:141583972-141583994 GGAGCAAAGAGCAGGAGGACGGG + Intronic
1033759309 7:144422731-144422753 CCTTCAAGCTGCAGGAGGAGGGG - Intergenic
1033909793 7:146248742-146248764 CGAGCAAAGAACAGGAGGACAGG + Intronic
1034333849 7:150307752-150307774 GGAGCAAAGAGCAGGAGGACAGG - Intronic
1035076278 7:156179565-156179587 CCAGCAAGGCTCAAGATGACAGG - Intergenic
1035115374 7:156519074-156519096 CCAGGCAGGTGCAGCAGGGCTGG - Intergenic
1036371856 8:8169125-8169147 AGAGCAAAGAGCAGGAGGACAGG - Intergenic
1036639159 8:10571532-10571554 AGAGCAAAGAGCAGGAGGACGGG - Intergenic
1036879046 8:12496519-12496541 AGAGCAAAGAGCAGGAGGACAGG + Intergenic
1037020721 8:13966957-13966979 CCTGTAAGGTGCAGGAGTAGGGG - Intergenic
1037952463 8:23028089-23028111 CCAGCCAAGTCCAGGAGGGCAGG - Intronic
1040647784 8:49420208-49420230 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1041652080 8:60311500-60311522 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1041695839 8:60735106-60735128 ACTGCAAGCTGCACGAGGACAGG + Intronic
1043718207 8:83510449-83510471 AGAGCAAAGAGCAGGAGGACAGG + Intergenic
1043837404 8:85063289-85063311 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1044258891 8:90095364-90095386 AGAGCAAAGAGCAGGAGGACAGG + Intronic
1044416775 8:91948476-91948498 GGAGCAAAGAGCAGGAGGACGGG - Intergenic
1044921660 8:97175502-97175524 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1045644483 8:104286390-104286412 GGAGCAAAGAGCAGGAGGACGGG - Intergenic
1046558980 8:115815103-115815125 CGAGCAAAGAGCAGGAGGACAGG - Intergenic
1047856087 8:128914919-128914941 AGAGCAAAGAGCAGGAGGACAGG - Intergenic
1048069186 8:131004015-131004037 CCAGCATGGTGGGGGAGGAAAGG - Intronic
1048585749 8:135772509-135772531 GGAGCAAAGAGCAGGAGGACGGG + Intergenic
1048728676 8:137413411-137413433 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1048786777 8:138058893-138058915 GTAGCATGGTGCAGCAGGACAGG - Intergenic
1049433691 8:142576662-142576684 CCTGCCAGGGACAGGAGGACAGG + Intergenic
1049718983 8:144106942-144106964 CCAGCACCATGGAGGAGGACAGG + Exonic
1050258378 9:3816294-3816316 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1050473869 9:6020518-6020540 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1050653811 9:7801718-7801740 CCAGAAAGGTAAATGAGGACTGG + Intronic
1051052342 9:12948876-12948898 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1051524070 9:18022931-18022953 CCAGCAAGGTGGAGAAGGATGGG - Intergenic
1052162884 9:25288642-25288664 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1052191528 9:25669380-25669402 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1052653011 9:31326805-31326827 AGAGCAAAGAGCAGGAGGACAGG - Intergenic
1053057674 9:35003755-35003777 AGAGCAAAGAGCAGGAGGACAGG - Intergenic
1054452460 9:65410422-65410444 CCAGGAAGGGACAGGATGACAGG + Intergenic
1054737515 9:68770387-68770409 CCAGCAAGGTGCAGGAGGACTGG - Intronic
1054807743 9:69409835-69409857 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1055348037 9:75357091-75357113 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1055989361 9:82088923-82088945 ACAGCAAGGTGCTGGAGCACTGG - Intergenic
1056045012 9:82705776-82705798 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1056437572 9:86588515-86588537 GGAGCAAAGAGCAGGAGGACGGG + Intergenic
1056795411 9:89655566-89655588 GCAGCCAAGGGCAGGAGGACTGG - Intergenic
1057314910 9:93961728-93961750 CCAGCAGGAGGCAGGAGGGCTGG - Intergenic
1057457474 9:95227591-95227613 TCAGCACAGTGCAGGAGGGCAGG - Intronic
1057683643 9:97215016-97215038 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1058026534 9:100146042-100146064 GGAGCAAAGAGCAGGAGGACAGG + Intronic
1058148354 9:101436513-101436535 CCAGCTAGGTTTTGGAGGACTGG - Intergenic
1059200832 9:112414555-112414577 CCAGCAAAGTGCAGATGGAAAGG + Intronic
1059546442 9:115179853-115179875 GGAGCAAAGAGCAGGAGGACAGG + Intronic
1059574284 9:115473683-115473705 GGAGCAAAGAGCAGGAGGACGGG - Intergenic
1060201555 9:121654536-121654558 CCACCAAGGAGGAGGAGGACAGG - Intronic
1060319027 9:122538151-122538173 CCAGGCAGGGGCAGGGGGACTGG - Intergenic
1060738199 9:126079945-126079967 AGAGCAAAGAGCAGGAGGACAGG + Intergenic
1060766012 9:126295594-126295616 ACTGCAAGCTCCAGGAGGACAGG - Intergenic
1060771519 9:126335514-126335536 CAAGCAAGGGACAGAAGGACAGG - Intronic
1060919970 9:127413711-127413733 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1061055956 9:128223046-128223068 CCAGCAAGTTGCAGTAGGCGGGG - Intronic
1061151201 9:128829291-128829313 CCAGAAAGCGGCAGGAGGGCAGG + Intronic
1061582787 9:131547671-131547693 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1061904615 9:133690365-133690387 CCAGCCAGGTGAGAGAGGACTGG - Exonic
1062027243 9:134346261-134346283 CCAGCAAGCCGCGGGAGGGCAGG - Intronic
1062076301 9:134591800-134591822 CCAGCAGGGTGTGGGAGGACAGG - Intergenic
1062119138 9:134824667-134824689 CCAGCCAGCTGCTGGACGACGGG + Exonic
1062340670 9:136092662-136092684 CTACCAAGGTGAAGGTGGACTGG + Intronic
1062344281 9:136107657-136107679 CCAGCCAGGTGGAGGAGGGTGGG + Intergenic
1062486601 9:136779780-136779802 CCAGCATGTTGCAGGAAGTCAGG - Intergenic
1062547752 9:137071224-137071246 CCAGCCAGGGGAAGGAGGAGAGG - Intergenic
1062610061 9:137369560-137369582 ACAGCAAGGGGCAGGTGGCCAGG + Intronic
1185858883 X:3559657-3559679 GGAGCAAAGAGCAGGAGGACGGG + Intergenic
1186113189 X:6277456-6277478 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1187100192 X:16183956-16183978 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1188201237 X:27294478-27294500 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1188419247 X:29975997-29976019 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1188430790 X:30104063-30104085 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1188463671 X:30454328-30454350 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1188552399 X:31378222-31378244 AGAGCAAGGAGCAGGAGGACAGG - Intronic
1190212452 X:48459338-48459360 CCAGCAGGGTCCAGGAAGACAGG - Intronic
1190360226 X:49642260-49642282 CCAGCAAGGTGCAGTGGCTCAGG - Intergenic
1192358650 X:70425082-70425104 CCAGCAAGGTGGAGTAGGGATGG + Exonic
1192601976 X:72474516-72474538 CCAGAAAGGAGGGGGAGGACAGG + Intronic
1192705840 X:73528174-73528196 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1193719987 X:84975063-84975085 CAAGCAAGGTGCAGGCGGGCCGG - Intergenic
1193885657 X:86982335-86982357 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1194186555 X:90778634-90778656 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1194503291 X:94704104-94704126 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1194874111 X:99164714-99164736 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1195112759 X:101664150-101664172 CAAAGAAGGTGGAGGAGGACAGG + Intergenic
1195291535 X:103434966-103434988 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1195908954 X:109870351-109870373 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1196109525 X:111930991-111931013 CCAAAAAGGAGGAGGAGGACAGG + Intronic
1196299742 X:114040539-114040561 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1196342055 X:114606721-114606743 GGAGCAAAGAGCAGGAGGACAGG + Intronic
1196533834 X:116817703-116817725 GGAGCAAAGAGCAGGAGGACGGG + Intergenic
1196572198 X:117279629-117279651 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1196992985 X:121348193-121348215 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1197064613 X:122222505-122222527 GGAGCAAAGAGCAGGAGGACGGG - Intergenic
1197352348 X:125394037-125394059 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1197470657 X:126863560-126863582 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1197793410 X:130277784-130277806 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1198598131 X:138259110-138259132 AGAGCAAAGAGCAGGAGGACAGG - Intergenic
1198599693 X:138269559-138269581 AGAGCAAAGAGCAGGAGGACAGG + Intergenic
1198983971 X:142428476-142428498 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1200182544 X:154159488-154159510 TCAGCATGGTGCAGGTGCACAGG + Intergenic
1200188198 X:154196602-154196624 TCAGCATGGTGCAGGTGCACAGG + Intergenic
1200193848 X:154233742-154233764 TCAGCATGGTGCAGGTGCACAGG + Intergenic
1200199603 X:154271546-154271568 TCAGCATGGTGCAGGTGCACAGG + Exonic
1200533157 Y:4360710-4360732 GGAGCAAAGAGCAGGAGGACAGG + Intergenic
1200659308 Y:5941611-5941633 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1200917053 Y:8580482-8580504 CCAGCAAGGCCCAGGATGAAGGG + Intergenic
1201393307 Y:13522024-13522046 CTAGCTAGGAGCAGCAGGACAGG - Intergenic
1201581093 Y:15512769-15512791 GGAGCAAAGAGCAGGAGGACAGG - Intergenic
1201936127 Y:19412514-19412536 GTAGCAAAGAGCAGGAGGACAGG - Intergenic
1202076846 Y:21044674-21044696 AGAGCAAAGAGCAGGAGGACAGG + Intergenic