ID: 1054737520

View in Genome Browser
Species Human (GRCh38)
Location 9:68770392-68770414
Sequence GACCCCCAGCAAGGTGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 288}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054737520_1054737525 1 Left 1054737520 9:68770392-68770414 CCTCCTGCACCTTGCTGGGGGTC 0: 1
1: 0
2: 4
3: 32
4: 288
Right 1054737525 9:68770416-68770438 GACTTCTCAGGGTAAAAATAAGG No data
1054737520_1054737526 8 Left 1054737520 9:68770392-68770414 CCTCCTGCACCTTGCTGGGGGTC 0: 1
1: 0
2: 4
3: 32
4: 288
Right 1054737526 9:68770423-68770445 CAGGGTAAAAATAAGGATGAAGG No data
1054737520_1054737527 16 Left 1054737520 9:68770392-68770414 CCTCCTGCACCTTGCTGGGGGTC 0: 1
1: 0
2: 4
3: 32
4: 288
Right 1054737527 9:68770431-68770453 AAATAAGGATGAAGGAGAGAAGG No data
1054737520_1054737524 -10 Left 1054737520 9:68770392-68770414 CCTCCTGCACCTTGCTGGGGGTC 0: 1
1: 0
2: 4
3: 32
4: 288
Right 1054737524 9:68770405-68770427 GCTGGGGGTCTGACTTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054737520 Original CRISPR GACCCCCAGCAAGGTGCAGG AGG (reversed) Intronic
900115345 1:1025699-1025721 GACCCCCTCCCAGCTGCAGGAGG - Intronic
900641004 1:3688031-3688053 GGCCCCCAGGAAAGGGCAGGCGG + Intronic
901022436 1:6261939-6261961 GGCCCCCATCAAGAAGCAGGAGG - Intergenic
901496562 1:9625844-9625866 GACCTCCAGCCAGGTGAGGGTGG + Intergenic
901817860 1:11805389-11805411 GACTCCCAGAAAGGTCCCGGCGG + Intronic
901838210 1:11937673-11937695 GATCCCCAGCAAGTGACAGGAGG + Intronic
902249036 1:15141241-15141263 GTACCCCAGCAAGGAGCAGGAGG + Intergenic
902287730 1:15417477-15417499 GACCCCAAGCAATTTGCTGGGGG - Intronic
902516459 1:16992233-16992255 AACCCCGAGACAGGTGCAGGGGG - Exonic
902818683 1:18930420-18930442 GCCACCCAGCCAGGTGAAGGCGG - Intronic
902826626 1:18979058-18979080 AACCCCCAGCCTGGTGGAGGAGG + Intergenic
902838825 1:19062772-19062794 GGCCTCCTGCAAGTTGCAGGTGG - Intergenic
902874503 1:19332749-19332771 GACCTGCAGGAAGGAGCAGGAGG - Intergenic
902918854 1:19654964-19654986 GAGGCACAGCAAGGTGCAGGGGG - Intronic
903551405 1:24159478-24159500 GACCTCCAGCAAGAAGCAGGTGG + Exonic
904403162 1:30270068-30270090 GACTCCCTGCAAGGGGGAGGTGG + Intergenic
904771571 1:32884207-32884229 GTCCCTCTGAAAGGTGCAGGTGG + Intergenic
905279987 1:36842931-36842953 GATCCCCAGGAAGGTGCTTGTGG + Intronic
906242107 1:44248401-44248423 GAGGCCCAGCAAAGTGCTGGGGG - Intronic
907503790 1:54902659-54902681 GCCCCCCAGAAAGGTGGAGAAGG + Intergenic
909667716 1:78154138-78154160 CACTCCCTCCAAGGTGCAGGAGG - Intergenic
910936639 1:92488346-92488368 GACACGCAGAAAGGAGCAGGTGG + Intergenic
912296264 1:108473901-108473923 GCCCCCCAGAAAGGTGGAGAAGG - Intergenic
915632428 1:157162821-157162843 GACCCCCATCATTGTGAAGGTGG + Intergenic
915992301 1:160530020-160530042 GACACCAAGCTAGCTGCAGGAGG - Intergenic
917091698 1:171359607-171359629 GACACCAAGCTAGCTGCAGGAGG + Intergenic
917307161 1:173638502-173638524 AACCTCCAGCAAGGAGCAAGGGG + Intronic
919905494 1:202075624-202075646 GAGCTCCAGCAAAGTCCAGGAGG - Intergenic
920440950 1:205980015-205980037 CACCATCATCAAGGTGCAGGAGG - Intronic
921157437 1:212449491-212449513 GACCCCCAGCCATCTGCAAGGGG - Intergenic
922705805 1:227789422-227789444 CACCCCCAGAAGGCTGCAGGAGG - Intergenic
1065121028 10:22530533-22530555 GACACCAAGCTAGCTGCAGGAGG - Intergenic
1065907610 10:30272177-30272199 GACACCAAGCTAGCTGCAGGAGG + Intergenic
1069584584 10:69589670-69589692 GAACCCCAGCATGGTACAAGGGG + Intergenic
1070391703 10:75976557-75976579 GCCCCTCTGCCAGGTGCAGGGGG - Intronic
1070485013 10:76922010-76922032 AGCCCCCAACAAGGTGCTGGAGG + Intronic
1071480602 10:86062165-86062187 GAGCCCCAGGTAGGTGCCGGGGG - Intronic
1071530446 10:86387360-86387382 CACCCACAGCAACGGGCAGGAGG - Intergenic
1071960874 10:90808241-90808263 GCCCCCCAGAAAGGTGGAGACGG - Intronic
1072402633 10:95121529-95121551 GACCCCCAGCAAACTGCTGCAGG - Intergenic
1072916357 10:99539528-99539550 GAACCCCAGCAAGGAGCAGTAGG - Intergenic
1075651115 10:124128823-124128845 CAACCCCAGCAAGGTGCAAAGGG + Intergenic
1076965214 11:77228-77250 GACACCGAGCTAGCTGCAGGAGG + Intergenic
1076993452 11:287621-287643 GGAACCCAGGAAGGTGCAGGAGG + Intergenic
1077283032 11:1754128-1754150 GACTCCCCGCAGGGTGGAGGTGG - Exonic
1077373696 11:2195384-2195406 GACACCCAGGTAGGAGCAGGGGG + Intergenic
1078094901 11:8290729-8290751 GAGGCCCAGCAATGGGCAGGAGG - Intergenic
1078721569 11:13889530-13889552 CACCCCCAGCCTGGTGCAGTTGG + Intergenic
1078927373 11:15886831-15886853 GACCACCAGCCTGATGCAGGTGG - Intergenic
1079094159 11:17500326-17500348 GACCCACAGCCAGGAGAAGGTGG - Intronic
1079920424 11:26427292-26427314 CACTGCCATCAAGGTGCAGGTGG - Intronic
1081640899 11:44753501-44753523 GACCCCCAGGAAGATGCTGGGGG - Intronic
1083776963 11:64898770-64898792 GGCCCCCAGCCAGGAGCTGGAGG - Exonic
1084087712 11:66862146-66862168 GAGCCGCAGCAAGGTGCAGGGGG + Intronic
1084232081 11:67760601-67760623 GTCCCCCAGAAAGGTGGAGAAGG - Intergenic
1084399817 11:68937021-68937043 GCCCGCCAGCAAGGAGCAGCAGG + Exonic
1084439879 11:69166777-69166799 GATCCCCAGCAGTGTGCTGGCGG + Intergenic
1085433774 11:76481001-76481023 GACACCGAGCTAGCTGCAGGAGG + Intronic
1085522996 11:77149210-77149232 AACCCCCAGCAGAGAGCAGGAGG + Intronic
1086491545 11:87361506-87361528 GTCCCCCAGCAATGTACAGCGGG + Intergenic
1087127591 11:94642511-94642533 GCCCCCCAGAAAGGTGAAGAAGG - Intergenic
1089848721 11:121479202-121479224 GGCCCCCAGGGAGGTGGAGGCGG + Intronic
1090680980 11:129057225-129057247 GATTCCCTGGAAGGTGCAGGAGG - Intronic
1092052407 12:5481013-5481035 CACCCCCAGTGAGGTGCACGTGG - Intronic
1092474249 12:8805787-8805809 GCCCCCCAGAAAGGTGGAGAAGG - Intergenic
1092887825 12:12940782-12940804 AGCCCCCAGCAAGATGCAGGAGG - Exonic
1093030870 12:14287330-14287352 GAATCTCAGCCAGGTGCAGGTGG - Intergenic
1095406304 12:41870606-41870628 GACACCGAGCTAGCTGCAGGAGG + Intergenic
1097259598 12:57710138-57710160 TACCCACAGCCAGGTGCGGGTGG - Intronic
1099878397 12:88437055-88437077 GACACCGAGCTAGCTGCAGGAGG + Intergenic
1101874616 12:108590066-108590088 GACGCCCAGCCTGGAGCAGGGGG - Exonic
1102996756 12:117357330-117357352 GACACCCAGCAAGGTCAAGGTGG + Intronic
1103564346 12:121808040-121808062 GACCCTGAGCGAGGTGCAGAGGG + Intronic
1105299031 13:19116962-19116984 CACCCCCAGCCAAGTGCAGCTGG + Intergenic
1106144208 13:27037211-27037233 GATCCCCAGCCAGCTTCAGGGGG + Intergenic
1107022726 13:35767857-35767879 GCCCCCCACCAAGCTCCAGGAGG - Intergenic
1107968881 13:45622438-45622460 GACACCAAGCTAGCTGCAGGAGG - Intergenic
1107970887 13:45641232-45641254 GACACCGAGCTAGCTGCAGGAGG - Intergenic
1109187862 13:59291777-59291799 GACACCGAGCAAGCTGCAGGAGG + Intergenic
1110761485 13:79235499-79235521 AACCCCCAGCGATTTGCAGGTGG + Intergenic
1110765241 13:79275004-79275026 GCCCCCCAGAAAGGCGCAGAAGG - Intergenic
1110824646 13:79958190-79958212 GACACCTAGCTAGCTGCAGGAGG + Intergenic
1111114177 13:83754513-83754535 GACACCAAGCTAGCTGCAGGAGG + Intergenic
1113263762 13:108593898-108593920 GACACCCAGGAGGGTGCAGCTGG + Intergenic
1113744206 13:112731634-112731656 GTCCCCAAGGAAGGTGCGGGAGG + Intronic
1116682765 14:47995735-47995757 GAGCCCCAGCAAGGTGACAGAGG - Intergenic
1118740693 14:68737389-68737411 GACACCAAGCAAAGAGCAGGAGG + Intergenic
1119659340 14:76439296-76439318 CAGCCCCAGCAAGGTGCTGTGGG - Intronic
1119681445 14:76595233-76595255 GACCCCCAGCAATGGGGAGGAGG - Intergenic
1119780351 14:77272871-77272893 GACCTGCAGCCAGGTGCAGCAGG + Intergenic
1119853415 14:77882240-77882262 GGCACCCAGCCAGGTGTAGGGGG + Intronic
1120554148 14:85908027-85908049 GACACCGAGCTAGCTGCAGGAGG - Intergenic
1122387690 14:101360376-101360398 GACCCCCAGCCAGAGGCAGCTGG - Intergenic
1122772645 14:104104194-104104216 GACCCCAAGCCAGGGGCAGCTGG - Intronic
1122975952 14:105170829-105170851 TCACCCCAGCAAGGTGCAGCAGG - Intergenic
1122985257 14:105208875-105208897 GGCCCCGAGGGAGGTGCAGGTGG - Intergenic
1129116296 15:73367307-73367329 TTCCCCCAGCGCGGTGCAGGAGG + Intronic
1132503967 16:297606-297628 GACCGCCAGCAACAGGCAGGAGG - Intronic
1134452567 16:14372526-14372548 GGCCTCCAGCAAGAAGCAGGTGG + Intergenic
1135322624 16:21507375-21507397 GAGCCCCAGCCAGCTGCAGAGGG - Intergenic
1135429871 16:22374221-22374243 GACCTCCAGCAAGGTGAGGGCGG - Exonic
1136334101 16:29600512-29600534 GAGCCCCAGCCAGCTGCAGAGGG - Intergenic
1136748093 16:32609834-32609856 CACCACCAGCAAGGTGCTGATGG + Intergenic
1138310192 16:56016971-56016993 GACACAGGGCAAGGTGCAGGAGG + Intergenic
1138492086 16:57382723-57382745 GACCCCCAGCAGGGAGCCAGTGG + Exonic
1138594243 16:58021246-58021268 CACCCCCAGCAAGGTGCCTGGGG + Exonic
1139545509 16:67647904-67647926 GATTCCCAGAAAGGTCCAGGTGG - Exonic
1141486279 16:84342366-84342388 AACCCCCAGCAGGGAGCAAGCGG + Intergenic
1141621818 16:85240387-85240409 GACCCCCACCAAGGGGGAGGGGG + Intergenic
1142034869 16:87856604-87856626 GAGCCCCAGCCAGCTGCAGAGGG - Intronic
1142114969 16:88351732-88351754 CCCCACCAGCAGGGTGCAGGGGG + Intergenic
1142131799 16:88434583-88434605 GACCAGCAGCAAGGAGCCGGAGG + Exonic
1142414792 16:89935483-89935505 GATCCCCAACAACGTGAAGGTGG + Exonic
1203050230 16_KI270728v1_random:869041-869063 CACCACCAGCAAGGTGCTGATGG + Intergenic
1142711602 17:1726723-1726745 GAGCCCCAGCCAGGCGCTGGGGG - Exonic
1144625375 17:16841765-16841787 CAGCCCCAGCAACGTGCAGGTGG + Intergenic
1144627002 17:16849108-16849130 GAGCACCAGCAAAGTTCAGGAGG - Intergenic
1144879438 17:18423604-18423626 GAGCACCAGCAAAGTTCAGGAGG + Intergenic
1144881050 17:18430956-18430978 CAGCTCCAGCAACGTGCAGGTGG - Intergenic
1145151182 17:20513430-20513452 CAGCTCCAGCAACGTGCAGGTGG + Intergenic
1145152803 17:20520783-20520805 GAGCACCAGCAAAGTTCAGGAGG - Intergenic
1146056728 17:29585082-29585104 GCCCCCCAGGAAGGTGTTGGCGG - Intronic
1146162537 17:30567684-30567706 CTGCCCCAGCAATGTGCAGGTGG + Intergenic
1146988500 17:37245079-37245101 CAACCCCAGCAAGGTTCAGCAGG - Exonic
1147185593 17:38711570-38711592 GGGCCCCAGCAAGGCCCAGGTGG - Intronic
1147189730 17:38731367-38731389 GACCCCCATCAAGGTGGAGCTGG + Exonic
1147579528 17:41620460-41620482 CTGCCCCAGCAACGTGCAGGTGG + Intronic
1148455139 17:47807459-47807481 GACCCCCAGCAGGGGGAAGGCGG + Exonic
1148469625 17:47885068-47885090 GACCCTCAGCAGGGTGGGGGTGG + Intergenic
1150554165 17:66238644-66238666 AACCCCCAGCCAGGTGCAGGTGG + Intronic
1150633016 17:66893577-66893599 GACCCCAAGGAAAGTGCTGGAGG + Intergenic
1151599519 17:75097674-75097696 GACCCCCAGCGAAGTGGGGGAGG + Intronic
1152839288 17:82556546-82556568 CAGCCCCAGCAAGGTGAGGGAGG - Intronic
1153268445 18:3295364-3295386 GACCCCCAGGAAGGAGCAGGGGG + Intergenic
1154389387 18:13923478-13923500 GACCCCAAACATGGTGCTGGGGG - Intergenic
1155540765 18:26865657-26865679 GACCCACAGCAAGGCGGTGGGGG - Exonic
1156386522 18:36610052-36610074 GACTCCCAGAAAGGTGAAAGGGG + Intronic
1158557227 18:58485469-58485491 GTCCCCCAGCCAGGAGGAGGAGG - Intronic
1158954383 18:62524450-62524472 GAGCCCCAGCCCGGCGCAGGTGG + Intronic
1160642019 19:146858-146880 GACACCGAGCTAGCTGCAGGAGG + Intergenic
1160720008 19:592894-592916 GACACCCAGCCAGGCACAGGAGG - Intronic
1161816226 19:6501721-6501743 CTCCCCCAGCAAGGTGAACGGGG + Intronic
1161908117 19:7172743-7172765 AACCCCCAGCTTGGTGCTGGTGG + Intronic
1164713189 19:30373888-30373910 GGGCCTCAGCAAGGTGCACGCGG + Intronic
1164748726 19:30635555-30635577 GGCTGCCTGCAAGGTGCAGGGGG + Intronic
1165075731 19:33278983-33279005 GACCCCCAGCCCAGGGCAGGAGG + Intergenic
1165387458 19:35519195-35519217 GACCCCCAGGAAGCGGGAGGGGG - Intergenic
1166780677 19:45340960-45340982 GAGCCCCAGGACGGGGCAGGGGG - Intronic
1166961017 19:46495774-46495796 GCACCGCAGCCAGGTGCAGGGGG + Exonic
1167358265 19:49016933-49016955 GACCCCCAGTAAGCTTCAGGTGG - Intronic
1167359761 19:49023822-49023844 GACCCCCAGTAAGCTTCAGGTGG - Intronic
1167361370 19:49032263-49032285 GACCCCCAGTAAGCTTCAGGTGG + Intronic
1167362281 19:49036522-49036544 GACCCCCAGTAAGCTTCAGGTGG - Exonic
1167363797 19:49044336-49044358 GACCCCCAGTAAGCTTCAGGTGG + Intronic
1167364700 19:49048591-49048613 GACCCCCAGTAAGCTTCAGGTGG - Intronic
1168228187 19:55011490-55011512 GCCCCCCAGAAAGGTGGAGAAGG + Intergenic
1168545155 19:57244060-57244082 GATCCCCTGCATGGTGGAGGGGG - Intronic
925059006 2:876610-876632 GAGGCCCATCAAGGAGCAGGGGG - Intergenic
927210496 2:20636181-20636203 GTCCCCCACCAAAGGGCAGGTGG + Intronic
927970968 2:27306325-27306347 GACTTCCAGCCAGGTGAAGGAGG + Exonic
929923490 2:46190542-46190564 GGTCCCTAGCAAGGTTCAGGTGG + Intergenic
931084586 2:58815212-58815234 GACCTCCATCAAGTTGCAGAGGG - Intergenic
931318028 2:61150695-61150717 GCCCCACAGCATGGAGCAGGAGG + Intronic
933163527 2:79052304-79052326 GCCCCCCAGAAAGGTGGAGAAGG - Intergenic
934674477 2:96239873-96239895 GAGCTCCAGCACCGTGCAGGTGG - Intergenic
934949458 2:98566452-98566474 GGCACCCAGCAAGGTCTAGGGGG + Intronic
935143127 2:100373045-100373067 GTCCCCCAGAAACCTGCAGGAGG - Intergenic
935237949 2:101153489-101153511 GACACACAACAAGGTGGAGGAGG + Intronic
937261792 2:120591351-120591373 GTCCCCCAGCAGGGTGGTGGTGG - Intergenic
942241359 2:173965626-173965648 GAGCGCCTGCAAGGTGGAGGAGG - Exonic
943105665 2:183543623-183543645 GACACCGAGCTAGCTGCAGGAGG + Intergenic
944764312 2:202849207-202849229 GACACCGAGCTAGCTGCAGGAGG + Intronic
944813228 2:203348885-203348907 CACCTTCAGCAAGGTTCAGGGGG - Intronic
945273194 2:207962205-207962227 GACCTCCAGGAAGGGGAAGGAGG + Intronic
946147908 2:217744628-217744650 GACCCACTGGAAGGTGCTGGAGG + Intronic
946333784 2:219024459-219024481 GACCTCCAGAAAGGGGCGGGGGG + Intronic
946886285 2:224226246-224226268 GCCCCCCAGAAAGGTGGAGAAGG - Intergenic
948389803 2:237603947-237603969 GAGCCCCGGGAAGATGCAGGAGG + Intergenic
948530317 2:238599880-238599902 GACCCCCAGCAGGAGGCATGTGG - Intergenic
948793066 2:240389063-240389085 GCCCCCAAGCAAGGTGGAAGTGG + Intergenic
1170150107 20:13220253-13220275 GAGCCCGAGCAAGGTCAAGGAGG + Intergenic
1172776937 20:37413417-37413439 GCCCCGCAGGAGGGTGCAGGGGG - Intergenic
1173274627 20:41568881-41568903 GACCCTAAGGAAAGTGCAGGAGG - Intronic
1173944728 20:46941412-46941434 GAGCCCCAGAAAGATGAAGGAGG - Intronic
1174575029 20:51531209-51531231 GAGCCCCAGCATGGCACAGGAGG + Intronic
1175183676 20:57165802-57165824 GTCCCCCATCCAGGAGCAGGTGG - Intergenic
1175375643 20:58521845-58521867 GAGGCACAGCAAGGGGCAGGGGG + Intergenic
1176121104 20:63454948-63454970 GTCCCCCAGCTTAGTGCAGGAGG - Intronic
1180130038 21:45821361-45821383 GGCCCACAGCGTGGTGCAGGGGG - Intronic
1180130054 21:45821420-45821442 GGCCCACAGCACGGTGCAGGGGG - Intronic
1180130069 21:45821479-45821501 GGCCCACAGCGTGGTGCAGGGGG - Intronic
1180801034 22:18632051-18632073 GTCTCCCTGGAAGGTGCAGGAGG - Intergenic
1181534629 22:23535020-23535042 CACCCCCTGCAAGGTCCTGGTGG + Intergenic
1182549537 22:31093437-31093459 TACCCCCGGCATGGTGCTGGTGG - Intronic
1183675887 22:39298609-39298631 GACCCCCAACACAGTGCAGGGGG + Intergenic
1184551910 22:45209153-45209175 GCTCCCCTGCTAGGTGCAGGAGG + Intronic
1185041515 22:48506785-48506807 AACCACCAGGATGGTGCAGGAGG + Intronic
1185148157 22:49150327-49150349 GACCCCAGGCCAGCTGCAGGAGG + Intergenic
1185275920 22:49950218-49950240 GGTCCCCAGGACGGTGCAGGAGG - Intergenic
949670932 3:6398555-6398577 GCCCCCCAGAAAGGTGGAGAAGG - Intergenic
953077368 3:39582680-39582702 GCCCCCCAGAAAGGTGGAGAAGG + Intergenic
954379532 3:50212322-50212344 CACCCCCAGCTGAGTGCAGGGGG + Intronic
957696718 3:83649422-83649444 AACCCCCAGCAAACTGCAGCAGG - Intergenic
957938036 3:86969033-86969055 CCCCCCAAACAAGGTGCAGGTGG + Exonic
961241617 3:125416495-125416517 GGCCCTCAGCAAGTTGCAGTGGG + Intergenic
961831131 3:129623555-129623577 GAGCCCCAGCACTGTGCTGGTGG + Intergenic
962156816 3:132956787-132956809 GACACCGAGCTAGCTGCAGGAGG + Intergenic
963456892 3:145555973-145555995 GCCCCCCAGAAAGGTGAAGAAGG + Intergenic
963715580 3:148799556-148799578 AACCCAGAGCAACGTGCAGGAGG - Intronic
964906745 3:161726711-161726733 GCCCCCCAGAAAGGTGGAGAAGG + Intergenic
965625105 3:170677323-170677345 GCCCCCCAGAAAGGTGGAGAAGG + Intronic
967123594 3:186405441-186405463 GATTGCCAGCAAGGGGCAGGGGG - Intergenic
967496019 3:190145504-190145526 GCCCCCCAGAAAGGTGGAGAAGG - Intergenic
967644044 3:191900163-191900185 GCCCCCCAGAAAGGTGGAGAAGG + Intergenic
968494357 4:907233-907255 GCCCCTCAGCTGGGTGCAGGTGG - Intronic
968578766 4:1380071-1380093 GAAGCCCAGCGAGGTGGAGGAGG + Exonic
968881501 4:3302583-3302605 GCCCCCGTGCAAGGGGCAGGAGG - Intronic
969747997 4:9089006-9089028 GACCCCCCGACAAGTGCAGGAGG - Intergenic
972801328 4:42478667-42478689 AACCCCCAGCAAGGTGCTAGAGG - Intronic
975533089 4:75420989-75421011 GACACCAAGCTAGCTGCAGGAGG - Intergenic
975908342 4:79242231-79242253 ATCCCCCTCCAAGGTGCAGGTGG - Intronic
976394877 4:84545037-84545059 GACACCAAGCTAGCTGCAGGAGG + Intergenic
976884786 4:89969540-89969562 GCCCCCCAGAAAGGTGGAGAAGG + Intergenic
979290576 4:118975557-118975579 CACCCCCAGGAAGGAGGAGGAGG + Intronic
980575845 4:134682619-134682641 GCCCCCCAGAAAGGTGGAGAAGG + Intergenic
982045904 4:151445445-151445467 TAGCCCCAGCAAGGTGGAGTGGG + Intronic
982414406 4:155113248-155113270 GCCCCCCAGAAAGGTGGAGAAGG + Intergenic
983299064 4:165902336-165902358 GACACCAAGCTAGCTGCAGGAGG - Intronic
983452118 4:167923819-167923841 GCCCCCCAGAAAGGTGGAGAAGG - Intergenic
984269870 4:177537178-177537200 GACCCTGAGCTAGCTGCAGGAGG - Intergenic
989204034 5:38793850-38793872 GACCATCAGCAGTGTGCAGGAGG - Intergenic
989582738 5:43048180-43048202 GCCCCTCAGTGAGGTGCAGGAGG + Intergenic
991026706 5:62037713-62037735 GACACCAAACTAGGTGCAGGAGG - Intergenic
992233522 5:74685526-74685548 TTCCTCCAGCAGGGTGCAGGAGG - Exonic
993894953 5:93522928-93522950 GACACCAAGCTAGCTGCAGGAGG + Intergenic
995179697 5:109219384-109219406 GGACCCCTGCAGGGTGCAGGAGG - Intergenic
995565053 5:113425835-113425857 CACCCCCAGCATGGTGAACGAGG - Intronic
995652003 5:114380276-114380298 GACCACCAGAAAGAAGCAGGGGG - Intronic
995833597 5:116378913-116378935 GCTCCCCAGCACGGGGCAGGAGG + Intronic
995899623 5:117051297-117051319 GCCCCCCAGAAAGGTGGAGAAGG + Intergenic
999245205 5:150150560-150150582 CACCCCCAGCCTGGTGCAGGAGG - Intronic
999488744 5:152027063-152027085 GACACCAAGCTAGCTGCAGGAGG - Intergenic
999959059 5:156735061-156735083 GATCCCCAGCAAACTGCAGCAGG - Intronic
1000411280 5:160936946-160936968 GTCCCCCAACAAAGTGCAGTTGG - Intergenic
1002189797 5:177472588-177472610 GGCCCCCAGCAAGGGGCACTCGG - Intronic
1002749686 6:96496-96518 GACACCGAGCTAGCTGCAGGAGG + Intergenic
1002944768 6:1750655-1750677 GACACCGAGCTAGCTGCAGGAGG + Intronic
1004105987 6:12668097-12668119 GCCCCCCAGAAAGGTGGAGAAGG - Intergenic
1004575009 6:16886895-16886917 GTCCCCCAGAAAGGTGGAGAAGG - Intergenic
1004768818 6:18758951-18758973 GCCCCCCAGAAAGGCGCAGAAGG + Intergenic
1005815366 6:29547535-29547557 GACACCAAGCTAGCTGCAGGAGG + Intergenic
1006175150 6:32117027-32117049 GACCCCCAGAAAGGTGAGTGTGG - Exonic
1006854451 6:37123466-37123488 AGCACCCAGCAGGGTGCAGGCGG + Intergenic
1007956292 6:45920764-45920786 GAGCCCCAGCAGGGCCCAGGAGG + Intronic
1008741654 6:54615646-54615668 AACCCCCAGCAAACTGCAGCAGG + Intergenic
1009343397 6:62586897-62586919 GCCCCCCAGAAAGGTGGAGAAGG - Intergenic
1013408119 6:109860629-109860651 GCCCCCCAGAAAGGTGGAGAAGG + Intergenic
1014413453 6:121154056-121154078 GACACCAAGCTAGGTGCAGGAGG - Intronic
1015291036 6:131538643-131538665 GACACCAAGCTAGCTGCAGGAGG + Intergenic
1016853044 6:148640685-148640707 GCCCCCCAGAAAGGTGGAGAAGG - Intergenic
1016886507 6:148964530-148964552 CACCCCCAGCATGAGGCAGGAGG + Exonic
1018059506 6:160079351-160079373 GGCCCCCAGCAGGGAGCAGGAGG + Intronic
1018530505 6:164757970-164757992 GACCCCCAGCTAGGGGCACGTGG + Intergenic
1018732830 6:166665675-166665697 GTCTCCCAGCAAGCTGCAGGCGG + Intronic
1019239103 6:170649943-170649965 GACACCGAGCTAGCTGCAGGAGG - Intergenic
1019320294 7:412028-412050 GGACCCCAGCATGGGGCAGGTGG + Intergenic
1019503818 7:1380514-1380536 GAGCCCCAGAAAGCAGCAGGAGG + Intergenic
1019572027 7:1717429-1717451 GACACCCAGGAAGGGGCAGGTGG + Intronic
1019795348 7:3044185-3044207 GACCCCCGGCAGAGTCCAGGTGG + Intergenic
1024325333 7:48105131-48105153 CACTCCTAGGAAGGTGCAGGGGG + Intronic
1024423127 7:49193410-49193432 GACCACCAGAAAGGGGCATGAGG - Intergenic
1024857421 7:53797663-53797685 GACCCCCAGCAAGGTGGGCAGGG - Intergenic
1027221038 7:76214127-76214149 GAACCACAGCATGGTGGAGGAGG - Intronic
1028344809 7:89766380-89766402 TACCACCAGCAATGTGCAAGGGG - Intergenic
1029757047 7:102580948-102580970 GACCCCCAGAAAGGAGGAGTGGG - Exonic
1030581410 7:111360344-111360366 GACCCCCTGCAAGGTTCATGGGG - Intronic
1030989780 7:116286516-116286538 CACTCCCAGCTGGGTGCAGGGGG - Intergenic
1035019731 7:155793876-155793898 GGCCTCCACCAAGGAGCAGGTGG - Intergenic
1035227325 7:157440953-157440975 GAAACCCAGCCAGGTGCATGGGG - Intergenic
1035291778 7:157844006-157844028 GACCCCCTGCACGGAGGAGGGGG + Intronic
1035508669 8:156665-156687 GACACCGAGCTAGCTGCAGGAGG + Intergenic
1035731227 8:1854829-1854851 ACCGCCCAGCAAGGTGCAGTGGG - Intronic
1039476826 8:37843195-37843217 GTGCCCCAGAAAGCTGCAGGTGG + Exonic
1040551993 8:48444925-48444947 GACCCCCTCCAGGGAGCAGGAGG - Intergenic
1043718131 8:83509993-83510015 GCCCCCCAGAAAGGTGGAGAAGG + Intergenic
1045938121 8:107706483-107706505 GACCCTCAGCAAGATGGATGGGG + Intergenic
1046949623 8:120007454-120007476 GACCTCCAAGAAGGGGCAGGTGG - Intronic
1048097384 8:131311081-131311103 GCCCCCCAGAAAGGTGGAGAAGG - Intergenic
1048410610 8:134168666-134168688 GTGCCCAAGCAAGGTCCAGGCGG - Intergenic
1049033683 8:140057956-140057978 TGCCCCCAGCGTGGTGCAGGTGG - Intronic
1049690534 8:143957033-143957055 AACCCCCAAGAAGGTGGAGGTGG + Intronic
1050369064 9:4902141-4902163 GACACCAAGCTAGCTGCAGGAGG - Intergenic
1051524074 9:18022936-18022958 GAAACCCAGCAAGGTGGAGAAGG - Intergenic
1051849697 9:21492200-21492222 GACCCCCAGAAAGGGAGAGGAGG - Intergenic
1052169630 9:25377351-25377373 GGCCCCCAGCAGTGTCCAGGCGG + Intergenic
1054737520 9:68770392-68770414 GACCCCCAGCAAGGTGCAGGAGG - Intronic
1055604702 9:77956639-77956661 GAGCCCCAGGAAGGGGGAGGAGG + Intronic
1058703963 9:107623757-107623779 CACCCTTAGCAAAGTGCAGGTGG - Intergenic
1060959931 9:127673189-127673211 AGTCCTCAGCAAGGTGCAGGTGG - Exonic
1061597771 9:131643282-131643304 GTCAGCCAGCAAGGTGCTGGAGG - Exonic
1061800359 9:133110226-133110248 GACCCGCAGCCAGGTGGGGGTGG + Intronic
1062008340 9:134252916-134252938 CACCCCCAGCACGGTGCACAGGG - Intergenic
1062113637 9:134796224-134796246 GACCCTCAGTAAGGGGCAGAAGG - Intronic
1062274815 9:135725749-135725771 GACCCTCAGCCGGGTCCAGGCGG + Intronic
1062295527 9:135823308-135823330 GACCCCCAACATGGACCAGGGGG + Intronic
1062344275 9:136107652-136107674 GCACCCCAGCCAGGTGGAGGAGG + Intergenic
1062759308 9:138330234-138330256 GACACCGAGCTAGCTGCAGGAGG - Intergenic
1203599758 Un_KI270748v1:1006-1028 GACACCGAGCTAGCTGCAGGAGG - Intergenic
1187100087 X:16183371-16183393 GCCCCCCAGAAAGGTGGAGAAGG + Intergenic
1189268117 X:39731645-39731667 GACTCCCAGCTTGCTGCAGGTGG + Intergenic
1189292411 X:39895637-39895659 GCCACCCATCAAGGTGAAGGTGG + Intergenic
1189300636 X:39949712-39949734 GACCCCCAGCATGGGCCAGCAGG + Intergenic
1191633604 X:63351553-63351575 GACCGCCAGAAAGGAGGAGGAGG - Intergenic
1192977317 X:76300083-76300105 GACACCCAACTAGCTGCAGGAGG - Intergenic
1193149003 X:78105310-78105332 TACCAGGAGCAAGGTGCAGGAGG + Intronic
1193719989 X:84975068-84975090 GAATTCAAGCAAGGTGCAGGCGG - Intergenic
1193768447 X:85560690-85560712 AACCCCCAGCAAACTGCAGCAGG - Intergenic
1194366888 X:93023886-93023908 GCCCCCCAGAAAGGTGGAGAAGG - Intergenic
1195841249 X:109179295-109179317 GCCCCCCAGAAAGGTGGAGAAGG - Intergenic
1195880621 X:109589454-109589476 CACACCCTGCAAGGTGCAGGTGG + Intergenic
1197248127 X:124187600-124187622 GACCCCCAGCATGGTGGAGGAGG - Intronic
1198027074 X:132717630-132717652 GACTACTAGCAAGGTGCATGGGG - Intronic
1200115399 X:153767711-153767733 CACCCCTAGCAAGGTGCCCGGGG - Exonic
1200214157 X:154360047-154360069 CTTCCCCAGCAAGCTGCAGGTGG - Exonic
1200675110 Y:6140142-6140164 GCCCCCCAGAAAGGTGGAGAAGG - Intergenic