ID: 1054737521

View in Genome Browser
Species Human (GRCh38)
Location 9:68770395-68770417
Sequence TCAGACCCCCAGCAAGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 304}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054737521_1054737525 -2 Left 1054737521 9:68770395-68770417 CCTGCACCTTGCTGGGGGTCTGA 0: 1
1: 0
2: 1
3: 30
4: 304
Right 1054737525 9:68770416-68770438 GACTTCTCAGGGTAAAAATAAGG No data
1054737521_1054737527 13 Left 1054737521 9:68770395-68770417 CCTGCACCTTGCTGGGGGTCTGA 0: 1
1: 0
2: 1
3: 30
4: 304
Right 1054737527 9:68770431-68770453 AAATAAGGATGAAGGAGAGAAGG No data
1054737521_1054737526 5 Left 1054737521 9:68770395-68770417 CCTGCACCTTGCTGGGGGTCTGA 0: 1
1: 0
2: 1
3: 30
4: 304
Right 1054737526 9:68770423-68770445 CAGGGTAAAAATAAGGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054737521 Original CRISPR TCAGACCCCCAGCAAGGTGC AGG (reversed) Intronic
901161760 1:7182943-7182965 GCAGTCCCCCAGCAATGTGTGGG - Intronic
901496561 1:9625841-9625863 TCAGACCTCCAGCCAGGTGAGGG + Intergenic
901776725 1:11565278-11565300 TCAGACCCCCAGCTCAGGGCAGG - Intergenic
902249035 1:15141238-15141260 TCTGTACCCCAGCAAGGAGCAGG + Intergenic
903336397 1:22627365-22627387 TCAAAGCCCCAGAAAGGGGCTGG + Intergenic
904594142 1:31632488-31632510 ACAGAGCTGCAGCAAGGTGCGGG - Exonic
904938145 1:34146301-34146323 TCAGAGCCCCAGCAGGGAGCAGG + Intronic
906269589 1:44465029-44465051 TCAGACCCTGTGTAAGGTGCTGG - Intronic
907724108 1:57002730-57002752 CCACCCCCACAGCAAGGTGCTGG - Intronic
908502487 1:64758067-64758089 TCAGAACCCAGGCAAGGTGATGG - Intronic
908598315 1:65711604-65711626 GCAGACACCCAGCTAGCTGCAGG - Intergenic
909158018 1:72105449-72105471 TCGGCCCCCCACCAAAGTGCAGG - Intronic
911673902 1:100637722-100637744 TCAGATCTCCAGCTGGGTGCTGG + Intergenic
913433653 1:118824374-118824396 TCTGTCCCCCAGAAAGATGCAGG + Intergenic
915809025 1:158886745-158886767 TCAGATCTCCAGCTGGGTGCTGG - Intergenic
917542961 1:175933311-175933333 TCAGACACTCAGCCGGGTGCTGG - Intergenic
917987343 1:180334176-180334198 TCAGATCTCCAGCTATGTGCTGG - Intronic
921184611 1:212658667-212658689 TCAGACCTCCAGCTGTGTGCTGG - Intergenic
921307109 1:213808264-213808286 TCAGATCTCCAGCTACGTGCTGG + Intergenic
922253458 1:223871221-223871243 GCAGACACCCAGCTAGCTGCAGG - Intergenic
922366843 1:224873559-224873581 TCAGACACCCAGCTGGGGGCTGG + Intergenic
1062965693 10:1606195-1606217 GTAGGCCCCCAGAAAGGTGCTGG - Intronic
1065651706 10:27899394-27899416 GCAGACACCCAGCTAGCTGCAGG + Intronic
1066105289 10:32151017-32151039 TCAGAACCCCAGCAGGTTGTAGG - Intergenic
1070391706 10:75976560-75976582 TCAGCCCCTCTGCCAGGTGCAGG - Intronic
1071401810 10:85280428-85280450 GCAGACACCCAGCTAGCTGCAGG - Intergenic
1071480605 10:86062168-86062190 TAAGAGCCCCAGGTAGGTGCCGG - Intronic
1072055418 10:91750262-91750284 TCAGATCTCCAGCTGGGTGCTGG - Intergenic
1072707310 10:97689971-97689993 TGAGACCCACAGAATGGTGCTGG + Intergenic
1072842292 10:98788304-98788326 TCAGACCTCCAGCTGCGTGCTGG + Intronic
1073599377 10:104831776-104831798 TCTGTGACCCAGCAAGGTGCAGG - Intronic
1074298371 10:112211407-112211429 TCTGAGCCCCAGAGAGGTGCAGG + Intronic
1075093443 10:119456187-119456209 TCACAGCCCCATCAATGTGCTGG + Intronic
1075911694 10:126130671-126130693 TCAGCCTCCCACAAAGGTGCAGG - Intronic
1076145421 10:128115408-128115430 TCAGACTCCCAGCAAGGCTGTGG - Exonic
1076185661 10:128446564-128446586 TCAGCCCCCCAAGAAGCTGCGGG + Intergenic
1077302670 11:1854485-1854507 CCAGACCCACAGCAATGTGACGG - Intronic
1080710024 11:34737906-34737928 GCAGACACCCAGCTAGCTGCAGG + Intergenic
1081396095 11:42588031-42588053 TAACACCCCCAGCAAGGTCTGGG - Intergenic
1081640902 11:44753504-44753526 TGGGACCCCCAGGAAGATGCTGG - Intronic
1082773462 11:57227637-57227659 TCAGGACCCCTGCAAGGTGATGG - Intergenic
1082890223 11:58131191-58131213 TCAGACCTCCACAAAGGTTCAGG + Intronic
1083063649 11:59900181-59900203 TCAGCCCACCTGCAAGGAGCTGG - Intergenic
1083509124 11:63191027-63191049 TCAGATCTCCAGCTATGTGCTGG + Intronic
1086870136 11:92027532-92027554 TCAGATCTCCAGCTGGGTGCTGG - Intergenic
1093208073 12:16275022-16275044 TCATACCCCCTGCCAGGTGATGG + Intronic
1094057817 12:26284570-26284592 TGAGGCCCCAAGCAAGGAGCAGG - Intronic
1095422470 12:42039630-42039652 TCAGACCCCAAGCAAGGAGGGGG + Intergenic
1096282072 12:50264682-50264704 TCTGACCTCAAGCAATGTGCTGG - Intronic
1096964283 12:55612660-55612682 TTGCACCCCCAGCAAGGTGCAGG + Intergenic
1099745009 12:86690373-86690395 TCAGACATCCAGCTAGCTGCAGG - Intronic
1102439292 12:112949058-112949080 TCAGATCCCCACCAAGGAGCTGG + Exonic
1103564943 12:121810745-121810767 TCAGAAGCCCAGCAGGGTCCGGG - Exonic
1104831577 12:131755931-131755953 CCAGATCCCCAGCGTGGTGCTGG + Intronic
1104913029 12:132249087-132249109 TCACATCTCCAGCAAGGAGCAGG + Intronic
1107393767 13:39994906-39994928 TCAGGCCCTCAGCAAGCTGCAGG - Intergenic
1107595099 13:41955331-41955353 TCAGAAATCCAGCAAGGTTCAGG - Intronic
1109187861 13:59291774-59291796 GCAGACACCGAGCAAGCTGCAGG + Intergenic
1109328620 13:60900414-60900436 GCAGACACCCAGCTAGCTGCAGG + Intergenic
1111915105 13:94352372-94352394 TCAGCCCTCCAGCAATGGGCAGG - Intronic
1112309885 13:98308928-98308950 TCAGCCCCCCACCAAAGTGCTGG + Intronic
1113556289 13:111238386-111238408 TAAGGCCTCCAGCAAAGTGCTGG + Intronic
1113847857 13:113402806-113402828 TCAGACGCCCAGGTGGGTGCCGG - Intergenic
1115233611 14:31187238-31187260 TCAGCCTCCCAGCAGGGAGCTGG - Intronic
1115977994 14:39017827-39017849 TCAGATCTCCAGCCACGTGCTGG - Intergenic
1116223233 14:42113851-42113873 TCATACCCCCAGCAAGCCGAGGG + Intergenic
1116696781 14:48187728-48187750 TCAGATCTCCAGCTACGTGCTGG - Intergenic
1118314562 14:64717751-64717773 GCAGAAGCCCAGGAAGGTGCTGG - Intronic
1121299840 14:92861609-92861631 CCAGGCACCCTGCAAGGTGCTGG - Intergenic
1122447684 14:101781521-101781543 TCAGGCGCCCAGGAAGGCGCAGG - Intronic
1123205113 14:106704814-106704836 TCAGGACACCAGGAAGGTGCTGG - Intergenic
1126505185 15:49396629-49396651 TCAGATCTCCAGCTGGGTGCTGG - Intronic
1126514595 15:49520822-49520844 TCAAACCCCCAGGAAGAAGCTGG + Intronic
1126537628 15:49783852-49783874 TCAGATCTCCAGCTGGGTGCTGG + Intergenic
1127637742 15:60887789-60887811 TGATGCCCGCAGCAAGGTGCCGG - Intronic
1129320984 15:74774763-74774785 TCAGCCTCCCAGCAAGTAGCTGG - Intergenic
1129940881 15:79495532-79495554 TCAGAGCCCCAGCCAGGAACTGG + Intergenic
1129967522 15:79750449-79750471 TCAGACCTCCAGCTGCGTGCTGG + Intergenic
1129999036 15:80031521-80031543 TCAGACACCCTGCTAGGTCCTGG - Intergenic
1130333367 15:82938449-82938471 TCAGAGACCAGGCAAGGTGCAGG - Intronic
1131376722 15:91930642-91930664 TCAGTCCCCGTACAAGGTGCTGG + Intronic
1132179573 15:99742162-99742184 TCAGTTCCCCAACAAGGTGGAGG - Intergenic
1132244664 15:100285079-100285101 TACCACCTCCAGCAAGGTGCTGG - Intronic
1132995495 16:2820414-2820436 GCTGACCCCCAGCAAGGCACTGG - Intronic
1136003521 16:27313723-27313745 CAAGACACCCAGCGAGGTGCTGG + Intronic
1138250659 16:55499425-55499447 TCAGACCCCATGGAAGGAGCAGG + Intronic
1141621815 16:85240384-85240406 CCAGACCCCCACCAAGGGGGAGG + Intergenic
1141735340 16:85848427-85848449 TCTGTCTCCCAGCAAGGTCCAGG + Intergenic
1142143365 16:88482537-88482559 TCAGACACCCAGGGAGGTGCTGG - Intronic
1142250337 16:88989070-88989092 TCAGACCCCCAGCCTCGTACAGG - Intergenic
1142321655 16:89387044-89387066 TCAGACCTCCTGGAAGGTGCAGG + Intronic
1142496552 17:309418-309440 CCGGACCCCCAGCAGGGGGCTGG - Intronic
1142496638 17:309646-309668 CCAGACCCCCAGCAGGGGGCTGG - Intronic
1143020741 17:3916156-3916178 TGACACCCCCCGCATGGTGCTGG - Exonic
1143400401 17:6639257-6639279 TCAGAGCCCCAGGAATCTGCGGG + Intronic
1143851558 17:9816034-9816056 ACAGAGCCCCAGGGAGGTGCAGG - Intronic
1145276519 17:21434626-21434648 TCAAACCTCCTGCCAGGTGCTGG - Intergenic
1145314360 17:21720519-21720541 TCAAACCCCCTGCCAGGTGCTGG - Intergenic
1145712814 17:26992495-26992517 TCAAACCCCCTGCCAGGTGCTGG - Intergenic
1146056729 17:29585085-29585107 TCAGCCCCCCAGGAAGGTGTTGG - Intronic
1147157591 17:38552065-38552087 TCAGTCCCCCAAGAAGGTGACGG - Exonic
1147877902 17:43634547-43634569 GCAGCCTCCCAGCAAGCTGCAGG - Intergenic
1148342387 17:46881084-46881106 TCAGACCCCCAGGAGGATCCTGG - Intronic
1148469624 17:47885065-47885087 CCAGACCCTCAGCAGGGTGGGGG + Intergenic
1150554164 17:66238641-66238663 TAAAACCCCCAGCCAGGTGCAGG + Intronic
1150934159 17:69617432-69617454 TCAGATCTCCAGCTATGTGCTGG + Intergenic
1151382757 17:73736920-73736942 TCAGAGCAGCAGCAAGGTGAAGG + Intergenic
1151557847 17:74855643-74855665 ACAGGCCCCCAGCCAGGTGAAGG + Intronic
1151599518 17:75097671-75097693 ACAGACCCCCAGCGAAGTGGGGG + Intronic
1152130957 17:78476200-78476222 TCAGACCCACAGCCACGTGCCGG + Intronic
1152130974 17:78476282-78476304 TCGGACCCACAGCCAAGTGCCGG + Intronic
1152130983 17:78476323-78476345 TCGGACCCACAGCCACGTGCCGG + Intronic
1152130992 17:78476364-78476386 TCGGACCCACAGCCACGTGCCGG + Intronic
1152920448 17:83064013-83064035 GCTGAGCCCCAGCCAGGTGCCGG - Intergenic
1153268442 18:3295361-3295383 TCTGACCCCCAGGAAGGAGCAGG + Intergenic
1154389390 18:13923481-13923503 TGAGACCCCAAACATGGTGCTGG - Intergenic
1155540768 18:26865660-26865682 ACAGACCCACAGCAAGGCGGTGG - Exonic
1158044006 18:53133221-53133243 GCAGATGCCCAGCAAGTTGCTGG + Intronic
1158054287 18:53260683-53260705 TCAGATCTCCAGCCATGTGCTGG + Intronic
1158267114 18:55671757-55671779 ACAGACCCCCAGCAGGGCACAGG + Intergenic
1158396992 18:57087178-57087200 TCAGTCCCCAAGCAAGGAGGGGG - Intergenic
1158425266 18:57334251-57334273 ACAGACCCACAGCAATGTTCTGG + Intergenic
1158640951 18:59203071-59203093 TCCCAGCCCCAGCAAGGAGCGGG - Intergenic
1159594990 18:70374432-70374454 TCAGCCTCCCACCAAAGTGCTGG - Intergenic
1160039776 18:75335103-75335125 GCAGACCCTCTGCAGGGTGCTGG - Intergenic
1160344722 18:78123680-78123702 CCAGATCCCCACCAAGGGGCAGG + Intergenic
1160622187 18:80179316-80179338 TCAGACGCTCAGCAAGGCCCAGG + Intronic
1160686378 19:438819-438841 TCAGGCCCCCAACAAGGCCCTGG - Exonic
1161903925 19:7140982-7141004 CCAGACACCATGCAAGGTGCTGG - Intronic
1162470147 19:10868204-10868226 TCAGACACTCAGCAAGGTAATGG - Intronic
1163784858 19:19269817-19269839 TCAGAGCCCCAGCCAGGGCCTGG + Intronic
1164772638 19:30822276-30822298 CTAGATCCCCAGGAAGGTGCTGG - Intergenic
1166369151 19:42291730-42291752 CCAGCCCCCCAGCAAGGTGAGGG + Exonic
1166980784 19:46630957-46630979 TCTGACCCCCAGCATGGGCCTGG + Intergenic
1167040648 19:47020906-47020928 TCAGGGTCCCAGCAAGGAGCTGG - Intronic
925185279 2:1842646-1842668 TCAGAGCCCCAGCGACCTGCAGG - Intronic
926507841 2:13738620-13738642 TCAGATCTCCAGCTGGGTGCTGG + Intergenic
927512677 2:23654200-23654222 TCAGGCTCCCAGGAAGGAGCTGG - Intronic
927634772 2:24805805-24805827 TCAGACCTCCAGCTGCGTGCTGG + Intronic
928082388 2:28322726-28322748 GGAGACCCCCAGCATGTTGCAGG + Intronic
931220593 2:60285125-60285147 TCTGCCCCCACGCAAGGTGCTGG - Intergenic
931638974 2:64364547-64364569 TCAGACCCCCAGTATGATACTGG - Intergenic
931750811 2:65328231-65328253 TCAGACCTCCAGCAAAGAGATGG + Intronic
932687454 2:73884740-73884762 TCAGACCCTCTTCTAGGTGCTGG + Intergenic
933576224 2:84071400-84071422 TCAGGACCCCAGGAAGCTGCTGG - Intergenic
935060281 2:99601306-99601328 GCAGACCCCAAGCCAGGTGCTGG - Intronic
935325800 2:101935749-101935771 GCAGACACCGAGCTAGGTGCAGG + Intergenic
935818276 2:106868304-106868326 ACAAATCCCCGGCAAGGTGCAGG + Intronic
936904963 2:117526031-117526053 TCAGATCTCCAGCTGGGTGCTGG - Intergenic
937316734 2:120936377-120936399 GCAGACACCCTGCAGGGTGCTGG + Intronic
937821740 2:126318138-126318160 TCAGTCCCTGAGCAAGGTGGGGG + Intergenic
938048001 2:128140411-128140433 TAAGACCCACAGCAGTGTGCTGG - Intronic
939116921 2:138071299-138071321 GCAGACACCCAGCTAGCTGCAGG - Intergenic
939723709 2:145687633-145687655 TCACAGACCCAGCAAAGTGCTGG - Intergenic
939876731 2:147586517-147586539 GCAGACACCCAGCTAGCTGCAGG - Intergenic
940565199 2:155351606-155351628 TCAGACACCAAGCTAGCTGCAGG - Intergenic
940823851 2:158387795-158387817 TCAGAGCACAAGCAAGGTGGGGG - Intronic
941728849 2:168893205-168893227 TCAGACCTCCAGCATAGTGGTGG - Intronic
942407189 2:175668404-175668426 TCAGACACCCAGCTACGTGCAGG + Intergenic
946147907 2:217744625-217744647 CCAGACCCACTGGAAGGTGCTGG + Intronic
947457634 2:230270001-230270023 ACAGACCCCCAGTAGGGTGGAGG + Intronic
948528881 2:238590240-238590262 TCAGACCCCGAGGAATCTGCTGG + Intergenic
1169277519 20:4243729-4243751 TGGGACCCCCAGGAAGCTGCTGG - Intronic
1169866143 20:10202130-10202152 TCAGAAACTCAGTAAGGTGCTGG - Intergenic
1171189937 20:23151550-23151572 TCCAACCCCCAGCAAGGGGCGGG - Intergenic
1173005010 20:39133564-39133586 TCAGACCACAAACAAGGTTCAGG - Intergenic
1173074341 20:39802471-39802493 TCAGATCTCCAGCTACGTGCTGG + Intergenic
1173274628 20:41568884-41568906 TCAGACCCTAAGGAAAGTGCAGG - Intronic
1173798541 20:45879766-45879788 ACAGTTCCCCAGCAAGTTGCTGG - Intergenic
1174111056 20:48198063-48198085 TCAGAACCCCTGCAAAGTGTGGG - Intergenic
1174980776 20:55392208-55392230 TCAGACTTGCAGCAAGGTGGAGG - Intergenic
1175620355 20:60440179-60440201 TCAGAATTCCAGCAAGGTGGTGG - Intergenic
1175981426 20:62740678-62740700 TCAGATCCCCAGAGAGGTGGGGG + Intronic
1176887682 21:14275423-14275445 TCAGCCCCCCACCAAGTAGCTGG - Intergenic
1179154381 21:38837014-38837036 TCAGGTCCCCAGCAAGGAGGAGG + Intergenic
1179585291 21:42370552-42370574 ACAGACCCACAGCATGGAGCGGG + Intergenic
1181783172 22:25207449-25207471 TGAGACTCCCAGGAAGGGGCTGG + Intergenic
1182870281 22:33640514-33640536 GCAGACACCCAGCTAGCTGCAGG + Intronic
1183946021 22:41326210-41326232 TCAGACTCCCACCAAGGCCCAGG - Intronic
1184216780 22:43072831-43072853 TCAAACTCCTCGCAAGGTGCTGG + Intronic
1185345908 22:50310547-50310569 TCAGACCTCCAGCCAGGTGGTGG - Exonic
949127981 3:469514-469536 TTAGCACCCCTGCAAGGTGCTGG + Intergenic
949888840 3:8716722-8716744 TCAGATCTCCAGCTGGGTGCTGG - Intronic
951330787 3:21365500-21365522 TCAGATCTCCAGCTATGTGCTGG - Intergenic
953001017 3:38932878-38932900 TCAGATCTCCAGCTGGGTGCTGG - Intronic
953032691 3:39188578-39188600 CCAGGACCCCAGCCAGGTGCGGG - Exonic
953127156 3:40102338-40102360 TCAGAGCCCCATCAAGGCTCAGG - Intronic
953315828 3:41925484-41925506 GCAGACACCAAGCTAGGTGCAGG + Intronic
956264211 3:67379339-67379361 TAAGACCTCCAGATAGGTGCAGG + Intronic
957948791 3:87097724-87097746 TCAGATCTCCAGCTGGGTGCTGG + Intergenic
958210527 3:90468357-90468379 TCAGATCCCCAGCTCCGTGCTGG + Intergenic
958828817 3:99064153-99064175 TCAGATCTCCAGCCATGTGCTGG + Intergenic
959076346 3:101753388-101753410 TCAGATCTCCAGCTGGGTGCTGG + Intronic
961422621 3:126818321-126818343 ACAGAACCCCAGCAAGGGACTGG - Intronic
961977478 3:131042176-131042198 GCAGACACCCAGCTAGCTGCAGG + Intronic
962195809 3:133362455-133362477 TCATACCCACACCATGGTGCAGG + Intronic
962276467 3:134018386-134018408 TCTGACCCCCAGCAATGGGGAGG - Intronic
962334764 3:134517229-134517251 TGAGTCCCCCAGCAAAGTGTGGG - Intronic
962708056 3:138063656-138063678 TCAGAACCCATGCAGGGTGCAGG + Intronic
963715581 3:148799559-148799581 TCAAACCCAGAGCAACGTGCAGG - Intronic
964602413 3:158516456-158516478 TCAGATCTCCAGCTGGGTGCTGG + Intronic
966309371 3:178576423-178576445 GCAGACACCGAGCAAGCTGCAGG + Intronic
966923474 3:184629586-184629608 TGTGACCCCAAGAAAGGTGCCGG + Intronic
968155524 3:196377922-196377944 TCAGCCTCCCACCAAAGTGCTGG + Intronic
968949469 4:3683190-3683212 TCCGAACCCCAGCCAGCTGCAGG + Intergenic
969134713 4:5020552-5020574 TGTGACCTCCAGCAAGTTGCTGG - Intergenic
969376437 4:6766561-6766583 ACAAGCCCCCAGCCAGGTGCTGG + Intergenic
969530118 4:7725874-7725896 ACAGAGCCCCAGCAAGGGGAGGG + Intronic
969582046 4:8071315-8071337 ACAGGACCCCAGCAAGGAGCCGG + Intronic
969927098 4:10594977-10594999 TCAGCCCCCCAGCCAGTAGCTGG - Intronic
970412009 4:15817935-15817957 GCAGACACCAAGCTAGGTGCAGG + Intronic
970647403 4:18138262-18138284 CAAGAGCCCCAGCAAGCTGCTGG - Intergenic
971116043 4:23647104-23647126 TCAGATCTCCAGCCATGTGCTGG + Intergenic
971456429 4:26849625-26849647 TCAGACGCCCAGCAAGTGACTGG + Intergenic
972425084 4:38925365-38925387 TCACAACCCCAGAAAGGTTCAGG + Intronic
972861096 4:43169720-43169742 GTAGACCCCCAGCAAACTGCAGG + Intergenic
973081796 4:46002786-46002808 TCAGAGCTCCAGCACTGTGCTGG + Intergenic
976158769 4:82176048-82176070 TCAGATCTCCAGCTGGGTGCTGG - Intergenic
976754291 4:88482057-88482079 TCAGCCTCCGAGCAAAGTGCTGG - Intronic
978089103 4:104692248-104692270 TCAGACCTCCAGCTGCGTGCTGG + Intergenic
978380593 4:108124320-108124342 TAACACCCCCAGCAAAGTGTGGG + Intronic
978893087 4:113852789-113852811 TCAGATCCCCAGCTGCGTGCTGG - Intergenic
979461643 4:120990755-120990777 GCAGACACCGAGCTAGGTGCAGG - Intergenic
980980164 4:139647964-139647986 TCAGGCCCCATGCTAGGTGCTGG - Intergenic
981493855 4:145369986-145370008 TCAGATCTCCAGCTACGTGCTGG - Intergenic
984152333 4:176149520-176149542 TCAGACTCCCAGGAAAGTGCTGG + Intronic
984640828 4:182162686-182162708 TCAGAAGCAGAGCAAGGTGCTGG - Intronic
985634602 5:1029935-1029957 TCAGGCCTCCTGCATGGTGCTGG - Intronic
985704978 5:1395157-1395179 TGAGGCCCCCAGGAAGGTGGAGG - Intronic
986637523 5:9837578-9837600 CCAGGCCCACAGGAAGGTGCAGG - Intergenic
988510932 5:31864151-31864173 TCAGAAGCCCAGCAAGGTTAGGG - Intronic
988879768 5:35488587-35488609 TGAGACCAACAGGAAGGTGCTGG + Intergenic
988985285 5:36612879-36612901 GCAGACCCTCAGCAAATTGCTGG - Intronic
989572552 5:42958126-42958148 CCAAACCCCCAGTGAGGTGCAGG + Intergenic
989582737 5:43048177-43048199 TCAGCCCCTCAGTGAGGTGCAGG + Intergenic
990239230 5:53800001-53800023 TCAGAGCTCCAACACGGTGCTGG - Intergenic
990708539 5:58557625-58557647 TCAGATCTCCAGCTGGGTGCTGG + Intronic
992812800 5:80407075-80407097 TCAGACTCCCAGCCAGTAGCTGG + Intergenic
993976767 5:94492407-94492429 TCAGACCCCAAGCCAGGTCAGGG + Intronic
996830896 5:127739289-127739311 TCAGATCTCCAGCTGGGTGCTGG + Intergenic
998040702 5:138949339-138949361 TGACACCCCCATCAGGGTGCTGG - Intronic
999570939 5:152919162-152919184 TCAGATCTCCAGCTATGTGCTGG + Intergenic
1000353553 5:160371833-160371855 TCAGTCCCCAAGCAAGGTGCTGG + Intergenic
1000860455 5:166450587-166450609 GCAGACACCAAGCTAGGTGCAGG - Intergenic
1002635159 5:180603650-180603672 TCGGTCTCCCAGCAAAGTGCTGG - Intronic
1003518322 6:6836027-6836049 CCAGGCCCCATGCAAGGTGCTGG - Intergenic
1003822254 6:9911658-9911680 TCAGACCCCCAGGAAGGGGTGGG + Intronic
1004287203 6:14332490-14332512 TCTGAGCCCAAGCAAAGTGCTGG - Intergenic
1005187561 6:23180367-23180389 TCCCACCCCCAGCAAGCTGCAGG + Intergenic
1006645785 6:35513059-35513081 TCAGATCCCCAGCAGCCTGCAGG + Intergenic
1007471599 6:42094205-42094227 TCACACCCCCAGCCAGCAGCTGG - Intergenic
1007545592 6:42691429-42691451 TCAGACCCCCACAAAGGGGCTGG - Exonic
1007606982 6:43124327-43124349 TCAGACTCCAAGAAAGGAGCTGG - Intronic
1007881867 6:45176707-45176729 TCAGATCTCCAGCTGGGTGCTGG - Intronic
1007890163 6:45281749-45281771 TCAGATCTCCAGCTGGGTGCTGG - Intronic
1007892388 6:45307279-45307301 TCAGACCTCCAGCTGTGTGCTGG - Intronic
1008212114 6:48737990-48738012 TCAGACCTCCAGCTGCGTGCTGG - Intergenic
1008968139 6:57335494-57335516 TCAGATCTCCAGCTGGGTGCTGG - Intronic
1010526419 6:76905565-76905587 TCAGATCTCCAGCTGGGTGCTGG + Intergenic
1010603701 6:77862736-77862758 TCAGATCCCCAGCTGCGTGCTGG - Intronic
1011376691 6:86694855-86694877 TCAGATCTCCAGCTATGTGCTGG + Intergenic
1012168786 6:95991790-95991812 TCAGGACCCCAGCAAGATCCTGG + Intergenic
1013735927 6:113227132-113227154 TCAGATCCCCAGCTGCGTGCTGG - Intergenic
1013898430 6:115121896-115121918 TCAGATCTCCAGCCACGTGCTGG - Intergenic
1014413454 6:121154059-121154081 ACAGACACCAAGCTAGGTGCAGG - Intronic
1018066927 6:160131091-160131113 TCAGACCCCCAGCCAGGCCTGGG - Intronic
1018586692 6:165368733-165368755 TCAGATCTCCAGCTACGTGCTGG - Intronic
1018890014 6:167976649-167976671 TCATTCCCCCAGCACTGTGCGGG + Intergenic
1019002628 6:168768035-168768057 TCAGACTCCCAGCATTCTGCAGG - Intergenic
1019416379 7:928732-928754 TCAGAGCCCCCGCACGCTGCTGG + Intronic
1019501802 7:1368540-1368562 TCTGGCCCCCAGAAAGGAGCAGG - Intergenic
1021014626 7:15517746-15517768 TCAGACACCGAGCTAGCTGCAGG + Intronic
1021093671 7:16511355-16511377 TCAGGGCCTCAGCACGGTGCAGG + Intronic
1021875682 7:25047224-25047246 TCAGATCTCCAGCTGGGTGCTGG + Intergenic
1022314581 7:29233586-29233608 TCAGACCCACAGGAAGATCCAGG - Intronic
1022648856 7:32256635-32256657 TCAGACCCACAGCAGGGTGGGGG - Intronic
1023314070 7:38917237-38917259 TCAGCCCCCCAGGGAGGGGCGGG + Intronic
1024632860 7:51263470-51263492 TCAGAAGCCCTGCAAAGTGCTGG + Intronic
1025734550 7:64135502-64135524 TCAGTCCCCCAGCAAGGAGGGGG - Intronic
1026160394 7:67863474-67863496 TCAGTCCCCCAGCAAGGATTGGG - Intergenic
1026555768 7:71407423-71407445 TCAGACCTTCAGCAAGGTCAAGG + Intronic
1026976659 7:74502830-74502852 TCTTACACCCAGCCAGGTGCAGG - Intronic
1027495998 7:78888390-78888412 TCAGATCTCCAGCTGGGTGCTGG - Intronic
1027972419 7:85102390-85102412 TCAGACTCTGAGCTAGGTGCTGG - Intronic
1029124969 7:98289412-98289434 CCAGACCCCCAGGAAGCAGCTGG + Intronic
1029620083 7:101684867-101684889 TCAGACCCACACCAAGGGGACGG - Intergenic
1031083628 7:117281487-117281509 TTTGACCCCCACCAAAGTGCTGG + Intronic
1031266386 7:119587352-119587374 TCAGATCTCCAGCTACGTGCTGG - Intergenic
1031357011 7:120799096-120799118 TTAGACCTCCAGCTAGGTACTGG - Intronic
1032019432 7:128398821-128398843 ACAGACCCCCAGGAACCTGCTGG - Intronic
1032476250 7:132213464-132213486 TCAGACCACATGCAAGGTGAAGG - Intronic
1032710407 7:134456016-134456038 TCAGACCCTCAGCAGGGCTCTGG - Intronic
1033535477 7:142308275-142308297 TCAGATCCCCGGGAAGGAGCAGG + Intergenic
1037719342 8:21429659-21429681 CCAAACCACCAGCAAAGTGCCGG + Intergenic
1037946938 8:22995674-22995696 GCAGAGCCCCAGCAGGGTGAAGG - Intronic
1040083418 8:43312642-43312664 TCAGATCTCCAGCTACGTGCTGG + Intergenic
1040428812 8:47317606-47317628 TCAGACCTCCAGCTGCGTGCTGG - Intronic
1043272406 8:78351148-78351170 TCAGATCTCCAGCTGGGTGCTGG - Intergenic
1044403045 8:91794198-91794220 TCAGACCTCCAGCTGCGTGCTGG - Intergenic
1044750304 8:95409331-95409353 TTAGCCCCTAAGCAAGGTGCTGG - Intergenic
1044940291 8:97335198-97335220 GCAGACACCCAGCTAGGTGAAGG - Intergenic
1048261263 8:132947086-132947108 CAAGAGCCTCAGCAAGGTGCAGG - Intronic
1049252856 8:141598418-141598440 GCAGACCCCCAGGAAAGTGAGGG - Intergenic
1049713911 8:144080579-144080601 TCAGTCCCCCAGCAAGATAGAGG - Exonic
1050065001 9:1750181-1750203 TCAGATCTCCAGCTACGTGCTGG - Intergenic
1051369226 9:16344060-16344082 CCAGGCCCCCAGCAAAGTGCTGG - Intergenic
1053270600 9:36746930-36746952 GCAGACCCCCATCAAGGTGGAGG + Intergenic
1053431520 9:38044826-38044848 TCAGGCCCCGTGCAAGGTGCAGG + Intronic
1053478143 9:38396612-38396634 TAAGAGCCCCAGCATCGTGCTGG + Exonic
1054737521 9:68770395-68770417 TCAGACCCCCAGCAAGGTGCAGG - Intronic
1054788632 9:69234230-69234252 GCAGGCCCATAGCAAGGTGCTGG + Intronic
1056200502 9:84271296-84271318 ACAGATCCCCAGCCAGTTGCTGG + Intergenic
1057259426 9:93575946-93575968 TCTGACCCCCACCACGGTGGGGG - Intergenic
1057340472 9:94197209-94197231 TCAGCTCCCCCGCAAGGCGCAGG + Intergenic
1057934057 9:99221917-99221939 GAAGACCCCCATCAGGGTGCGGG - Exonic
1060036389 9:120259640-120259662 TCAGGTTCCCAGCAGGGTGCTGG + Intergenic
1061059078 9:128241544-128241566 CCAGGCCCTCTGCAAGGTGCTGG + Intronic
1061975503 9:134066430-134066452 TCTGAACCCCTGCAAGGGGCTGG - Intronic
1062149954 9:135012989-135013011 ACAGAGCCCCACCAAGGGGCAGG - Intergenic
1203408123 Un_KI270538v1:66545-66567 TCAGATCTCCAGCTGGGTGCTGG - Intergenic
1185562822 X:1072764-1072786 GCACACACCCAGCAGGGTGCAGG + Intergenic
1187602349 X:20846091-20846113 TCAGATCTCCAGCTATGTGCTGG - Intergenic
1188564267 X:31507947-31507969 ACAGACTCCCAGGAATGTGCTGG - Intronic
1189362764 X:40366025-40366047 ACAGATCCCATGCAAGGTGCTGG - Intergenic
1191024065 X:55894629-55894651 TCACAGCACCAGCAAGGTGGAGG - Intergenic
1192225864 X:69227432-69227454 TCAGGCCCTCTGCTAGGTGCTGG + Intergenic
1192249307 X:69397777-69397799 TCAGGCCCTAAGCTAGGTGCTGG + Intergenic
1192340186 X:70257922-70257944 TCAGGCCCCCAGCTACATGCGGG + Intergenic
1194515364 X:94845250-94845272 GCAGACACCCAGCTAGCTGCAGG - Intergenic
1195702700 X:107716772-107716794 TCAGACCCCCATGGAGGTGGCGG - Intronic
1196281210 X:113825575-113825597 GAAGACACCAAGCAAGGTGCAGG - Intergenic
1198418504 X:136445633-136445655 TCAGACCTCCAGCTGCGTGCTGG + Intergenic
1199768105 X:150955011-150955033 TCAGAGCCTCAGCAACATGCTGG + Intergenic
1200583080 Y:4973888-4973910 TCAGATCTCCAGCTGGGTGCTGG - Intergenic
1201494238 Y:14576069-14576091 TCAGATCTCCAGCTGGGTGCTGG + Intronic
1201979301 Y:19890476-19890498 TCAGAGCTCCAGCACTGTGCTGG + Intergenic