ID: 1054737526

View in Genome Browser
Species Human (GRCh38)
Location 9:68770423-68770445
Sequence CAGGGTAAAAATAAGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054737514_1054737526 16 Left 1054737514 9:68770384-68770406 CCACCAGTCCTCCTGCACCTTGC 0: 1
1: 0
2: 3
3: 26
4: 311
Right 1054737526 9:68770423-68770445 CAGGGTAAAAATAAGGATGAAGG No data
1054737521_1054737526 5 Left 1054737521 9:68770395-68770417 CCTGCACCTTGCTGGGGGTCTGA 0: 1
1: 0
2: 1
3: 30
4: 304
Right 1054737526 9:68770423-68770445 CAGGGTAAAAATAAGGATGAAGG No data
1054737512_1054737526 27 Left 1054737512 9:68770373-68770395 CCTGCCTTTTGCCACCAGTCCTC 0: 1
1: 0
2: 1
3: 25
4: 207
Right 1054737526 9:68770423-68770445 CAGGGTAAAAATAAGGATGAAGG No data
1054737513_1054737526 23 Left 1054737513 9:68770377-68770399 CCTTTTGCCACCAGTCCTCCTGC 0: 1
1: 0
2: 0
3: 27
4: 324
Right 1054737526 9:68770423-68770445 CAGGGTAAAAATAAGGATGAAGG No data
1054737515_1054737526 13 Left 1054737515 9:68770387-68770409 CCAGTCCTCCTGCACCTTGCTGG 0: 1
1: 0
2: 1
3: 44
4: 689
Right 1054737526 9:68770423-68770445 CAGGGTAAAAATAAGGATGAAGG No data
1054737522_1054737526 -1 Left 1054737522 9:68770401-68770423 CCTTGCTGGGGGTCTGACTTCTC 0: 1
1: 0
2: 2
3: 20
4: 215
Right 1054737526 9:68770423-68770445 CAGGGTAAAAATAAGGATGAAGG No data
1054737520_1054737526 8 Left 1054737520 9:68770392-68770414 CCTCCTGCACCTTGCTGGGGGTC 0: 1
1: 0
2: 4
3: 32
4: 288
Right 1054737526 9:68770423-68770445 CAGGGTAAAAATAAGGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054737526 Original CRISPR CAGGGTAAAAATAAGGATGA AGG Intronic
No off target data available for this crispr