ID: 1054739314

View in Genome Browser
Species Human (GRCh38)
Location 9:68788702-68788724
Sequence GCTCACGTTTAGGACCCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 32}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054739312_1054739314 -5 Left 1054739312 9:68788684-68788706 CCTTTGTCGTGGAGTCAGGCTCA 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1054739314 9:68788702-68788724 GCTCACGTTTAGGACCCCTTTGG 0: 1
1: 0
2: 0
3: 4
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054739314 Original CRISPR GCTCACGTTTAGGACCCCTT TGG Intronic