ID: 1054743074

View in Genome Browser
Species Human (GRCh38)
Location 9:68828104-68828126
Sequence ACCAGGGCCTTGACTGTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054743068_1054743074 5 Left 1054743068 9:68828076-68828098 CCGTTGGACTGGGTCAGTGTTTC 0: 1
1: 0
2: 1
3: 22
4: 170
Right 1054743074 9:68828104-68828126 ACCAGGGCCTTGACTGTCATGGG No data
1054743063_1054743074 22 Left 1054743063 9:68828059-68828081 CCCATGTTGTCATTTGTCCGTTG 0: 1
1: 0
2: 0
3: 13
4: 121
Right 1054743074 9:68828104-68828126 ACCAGGGCCTTGACTGTCATGGG No data
1054743064_1054743074 21 Left 1054743064 9:68828060-68828082 CCATGTTGTCATTTGTCCGTTGG 0: 1
1: 0
2: 0
3: 11
4: 158
Right 1054743074 9:68828104-68828126 ACCAGGGCCTTGACTGTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054743074 Original CRISPR ACCAGGGCCTTGACTGTCAT GGG Intronic
No off target data available for this crispr