ID: 1054743988

View in Genome Browser
Species Human (GRCh38)
Location 9:68835720-68835742
Sequence TATTGACTATTGAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054743981_1054743988 6 Left 1054743981 9:68835691-68835713 CCCCATTCTCCTTCTGTGGTAGT 0: 1
1: 0
2: 2
3: 18
4: 324
Right 1054743988 9:68835720-68835742 TATTGACTATTGAAGGTGGAAGG No data
1054743984_1054743988 -3 Left 1054743984 9:68835700-68835722 CCTTCTGTGGTAGTCCTTATTAT 0: 1
1: 0
2: 0
3: 11
4: 239
Right 1054743988 9:68835720-68835742 TATTGACTATTGAAGGTGGAAGG No data
1054743982_1054743988 5 Left 1054743982 9:68835692-68835714 CCCATTCTCCTTCTGTGGTAGTC 0: 1
1: 0
2: 1
3: 10
4: 315
Right 1054743988 9:68835720-68835742 TATTGACTATTGAAGGTGGAAGG No data
1054743977_1054743988 29 Left 1054743977 9:68835668-68835690 CCCATTCCAATTGCAGATTGGGA 0: 1
1: 0
2: 0
3: 4
4: 91
Right 1054743988 9:68835720-68835742 TATTGACTATTGAAGGTGGAAGG No data
1054743979_1054743988 23 Left 1054743979 9:68835674-68835696 CCAATTGCAGATTGGGACCCCAT 0: 1
1: 0
2: 0
3: 8
4: 62
Right 1054743988 9:68835720-68835742 TATTGACTATTGAAGGTGGAAGG No data
1054743978_1054743988 28 Left 1054743978 9:68835669-68835691 CCATTCCAATTGCAGATTGGGAC 0: 1
1: 0
2: 0
3: 5
4: 82
Right 1054743988 9:68835720-68835742 TATTGACTATTGAAGGTGGAAGG No data
1054743983_1054743988 4 Left 1054743983 9:68835693-68835715 CCATTCTCCTTCTGTGGTAGTCC 0: 1
1: 0
2: 0
3: 8
4: 234
Right 1054743988 9:68835720-68835742 TATTGACTATTGAAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054743988 Original CRISPR TATTGACTATTGAAGGTGGA AGG Intronic
No off target data available for this crispr