ID: 1054744707

View in Genome Browser
Species Human (GRCh38)
Location 9:68843018-68843040
Sequence CGTGAAGGGCAGAGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 568
Summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 515}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054744707_1054744714 -7 Left 1054744707 9:68843018-68843040 CCAGCTTCCCTCTGCCCTTCACG 0: 1
1: 0
2: 3
3: 49
4: 515
Right 1054744714 9:68843034-68843056 CTTCACGTCTGTGGGTCCTATGG No data
1054744707_1054744719 26 Left 1054744707 9:68843018-68843040 CCAGCTTCCCTCTGCCCTTCACG 0: 1
1: 0
2: 3
3: 49
4: 515
Right 1054744719 9:68843067-68843089 TTATGTATTGTTTTTCTTTGGGG No data
1054744707_1054744717 24 Left 1054744707 9:68843018-68843040 CCAGCTTCCCTCTGCCCTTCACG 0: 1
1: 0
2: 3
3: 49
4: 515
Right 1054744717 9:68843065-68843087 TTTTATGTATTGTTTTTCTTTGG No data
1054744707_1054744715 -1 Left 1054744707 9:68843018-68843040 CCAGCTTCCCTCTGCCCTTCACG 0: 1
1: 0
2: 3
3: 49
4: 515
Right 1054744715 9:68843040-68843062 GTCTGTGGGTCCTATGGTTGAGG No data
1054744707_1054744718 25 Left 1054744707 9:68843018-68843040 CCAGCTTCCCTCTGCCCTTCACG 0: 1
1: 0
2: 3
3: 49
4: 515
Right 1054744718 9:68843066-68843088 TTTATGTATTGTTTTTCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054744707 Original CRISPR CGTGAAGGGCAGAGGGAAGC TGG (reversed) Intronic
900399012 1:2465357-2465379 GGTGGAGGGCAGAGGGCAGAGGG - Intronic
901167225 1:7229445-7229467 TGTGAAGGGGAGAAGGAAGGAGG + Intronic
901735625 1:11310443-11310465 CGTGAAGGGCAGAGCAATGGAGG - Intergenic
903347311 1:22695001-22695023 CGTGAAGTGCTGAGGGATGAGGG + Intergenic
903377610 1:22876538-22876560 CGAGAGGGGCAGGGGGAGGCCGG - Intronic
904078820 1:27859120-27859142 CGTGCAGGGCAGGGTGAGGCTGG - Intergenic
904113819 1:28147413-28147435 CCTGGAGGACTGAGGGAAGCCGG + Exonic
904378600 1:30096621-30096643 CATCATGGTCAGAGGGAAGCAGG + Intergenic
904916715 1:33975700-33975722 GGTGAAGGGCATCTGGAAGCTGG + Intronic
904961999 1:34340726-34340748 TGTAACGGGCAGAAGGAAGCAGG - Intergenic
905232160 1:36521317-36521339 AGTGAAGGGCAGAGGGGACCTGG + Intergenic
905392938 1:37649899-37649921 CGAGAACTGCAGATGGAAGCGGG - Intergenic
906060331 1:42944238-42944260 CAGGAAGGGCAGAGGCCAGCAGG + Intronic
906708724 1:47913673-47913695 AAGGAAGGGAAGAGGGAAGCAGG - Intronic
907673809 1:56500362-56500384 ACTGAAGGGGAGTGGGAAGCAGG + Intronic
908261858 1:62345270-62345292 CGTTAAGAGCAGATGGAGGCTGG + Intergenic
908354579 1:63317610-63317632 CGAGAGGGGCCGAGGAAAGCAGG - Intergenic
908879620 1:68716076-68716098 ACTGAGGGGCTGAGGGAAGCTGG - Intergenic
909389327 1:75100609-75100631 GGAGAAAGACAGAGGGAAGCTGG - Intergenic
909699107 1:78500605-78500627 TGTGAAGTGGAGAAGGAAGCAGG - Intronic
909751257 1:79164735-79164757 GGAGAAGTGCAGAGGGAAGTGGG - Intergenic
909820933 1:80059935-80059957 GGAGAAGTGCAGAGTGAAGCAGG + Intergenic
910547843 1:88439290-88439312 TGGGAAGGGTAGTGGGAAGCAGG + Intergenic
912011265 1:104966550-104966572 AGGGAAGGGAAGAGGGAAGAGGG - Intergenic
912450300 1:109764131-109764153 CCTAAAAGGCAGAGGGAAGAGGG - Intronic
913011810 1:114690825-114690847 CATGAAGGGCAAATGGAAACAGG + Intronic
914224364 1:145707867-145707889 AATCCAGGGCAGAGGGAAGCAGG - Intronic
914433742 1:147641849-147641871 CGGGAAGGGCAGGCGGAGGCGGG + Intronic
916690652 1:167186936-167186958 GGTGAAGGGCAGAAGGCAGAAGG - Intergenic
918561133 1:185868518-185868540 AGAGAAGGGCTGAGTGAAGCAGG - Intronic
919119036 1:193315855-193315877 CGTTAAAGGGAGAGGGAAGGAGG - Intergenic
919329566 1:196153211-196153233 CGTCAAGGGGAGGGGGAAGCGGG - Intergenic
919819338 1:201463103-201463125 CATCAAGGGCAGAGGGCAGGTGG - Intergenic
919839618 1:201599350-201599372 AGTGAAGGTCAAAGGGAGGCTGG - Intergenic
919866745 1:201788445-201788467 CTGGAAGGACAGAGGGAAGGGGG - Intronic
919936291 1:202252850-202252872 CTTGAAAGTCAGAGGGAAGAAGG + Intronic
920646339 1:207806802-207806824 AGTGGAGGGCAAAGGGAAGGAGG + Intergenic
921121516 1:212141611-212141633 CATGAAGGGCAGGGCGGAGCTGG - Intergenic
921200863 1:212804745-212804767 CTTGAAGGGCAGGGGCAAGAAGG + Intronic
922481275 1:225941271-225941293 GGTGAAGGGAAGAGGGAGGGAGG + Exonic
922755704 1:228095720-228095742 CTTGAAGGGCAGAGAGAAAAGGG - Intronic
922767941 1:228165774-228165796 CGGGAAGGGCCCAAGGAAGCGGG - Intergenic
923035902 1:230285018-230285040 GGTGGAAGGCAGAGGGGAGCAGG + Intergenic
924318123 1:242819649-242819671 CCTGAAGGACAGTGGGAAGTAGG + Intergenic
1062842711 10:683484-683506 CGGGAAGGGAAGGTGGAAGCAGG + Intronic
1063067412 10:2623750-2623772 CATGACAGGGAGAGGGAAGCAGG + Intergenic
1063091677 10:2871026-2871048 AGTGGGGGGCAGAGGGAAGAAGG - Intergenic
1063112339 10:3047901-3047923 CGGGGAGGGGAGAGAGAAGCAGG - Intergenic
1063487887 10:6436952-6436974 TGTGAAGCACAGGGGGAAGCTGG + Intronic
1065202928 10:23331297-23331319 AGGGAAGGGAAGAGGGAAGAGGG + Intronic
1066226313 10:33386874-33386896 CCTGACAGGCAGAGGGAAGATGG + Intergenic
1066762557 10:38769442-38769464 AGAGAAGGGCAGAGGGAAAGGGG - Intergenic
1067552938 10:47247848-47247870 CCTGAGGGGCAGAGGGAGGCAGG + Intergenic
1067704369 10:48596148-48596170 CAGCAAGGGCAGTGGGAAGCCGG + Intronic
1068788925 10:61006695-61006717 AGTGGAAGGCAGAGGAAAGCAGG - Intergenic
1069994876 10:72336003-72336025 TGTGGAGGGCGGAGGAAAGCTGG + Intronic
1070333165 10:75431991-75432013 CGCTAAGGGCAGAAGGAAGTGGG - Intronic
1070483906 10:76911697-76911719 CAAGAGAGGCAGAGGGAAGCTGG - Intronic
1070957140 10:80471665-80471687 CTTCAATGGCAGAGGGAAGTAGG + Intronic
1071116675 10:82229640-82229662 AGAGAAGTGCAGAGCGAAGCAGG + Intronic
1071404576 10:85317818-85317840 AGTCAAGGGAAGAGGGATGCTGG + Intergenic
1071437704 10:85662496-85662518 TGTGCAGGGCGGAGGGAGGCAGG - Intronic
1072221538 10:93331527-93331549 CGTGAGGGAGACAGGGAAGCAGG - Intronic
1072539652 10:96388693-96388715 AGGGCAGGGTAGAGGGAAGCTGG - Intronic
1073560743 10:104494630-104494652 CGGGAAGGGTAGAGGGGAGGAGG - Intergenic
1074850397 10:117434758-117434780 AGGGAAGGGGAGAGGCAAGCAGG - Intergenic
1075126764 10:119706678-119706700 GGAGAAGTGCAGAGTGAAGCAGG - Intergenic
1075417078 10:122272033-122272055 TGTCTAGGGCAGTGGGAAGCTGG + Intronic
1075726555 10:124613546-124613568 CATGCAGGGCAGAGGGCAGAAGG - Exonic
1076109724 10:127851297-127851319 CGGGAAGGGCAGCTGAAAGCAGG + Intergenic
1076157685 10:128216094-128216116 GGTGGAGGGCAGAGGGCAGAGGG + Intergenic
1076502696 10:130949704-130949726 GGTGCGGGGCAGAGGGAGGCTGG - Intergenic
1076633629 10:131868528-131868550 CTTGAAGGGCAGCGGGAGGCAGG - Intergenic
1076721393 10:132394965-132394987 CGGGCAGGGCAGAGGGAAGGTGG + Intergenic
1076721400 10:132394985-132395007 TGGGCAGGGCAGAGGGAAGGCGG + Intergenic
1077044382 11:537933-537955 GGTGAAGGGGCGAGGGCAGCAGG + Intronic
1077667386 11:4125277-4125299 TGTCAAGGGCTGAGGGAAGAAGG - Intronic
1080249635 11:30218527-30218549 CATGAATGGGAGAGGGATGCTGG + Intergenic
1080686764 11:34522446-34522468 CAGGAAGGGCAGAGGCAACCAGG + Intergenic
1081831668 11:46120550-46120572 GGTGGAGGGCAGAGGGGAGGGGG + Intronic
1083028378 11:59570092-59570114 AATGGAGGGCAGAGGGAAGAAGG - Intergenic
1083389166 11:62335433-62335455 GGGGAAGGGCAAAGGGAAGAAGG - Intergenic
1083578986 11:63813275-63813297 CGGGAAGGGCCGAGGGGACCCGG - Intergenic
1083656630 11:64232886-64232908 GGTGATGGGCAGAGGGCAGGAGG + Intronic
1083672603 11:64307365-64307387 CGAGCAGGGCGGTGGGAAGCTGG + Exonic
1085270095 11:75265147-75265169 GGAGAATGGCAGGGGGAAGCAGG + Exonic
1085629701 11:78104363-78104385 AGTGAAGAGCAGAGGAAAGAGGG + Exonic
1085681085 11:78575450-78575472 GTTGGAGGGCAGAGGGAAGAGGG - Intergenic
1088823198 11:113474221-113474243 CTTGAAGAGCAGAGGTAAGAGGG - Intronic
1089133638 11:116232105-116232127 CTTGAAGGGCTGGGGGAAGGAGG - Intergenic
1089230232 11:116967819-116967841 CCTGATGGGCACAGGGAGGCTGG - Intronic
1089639832 11:119840297-119840319 CGGGAAGGGCACAGGATAGCAGG + Intergenic
1089681462 11:120121259-120121281 TGCGAAGGGCAGAGGGCATCAGG - Intronic
1089742111 11:120591598-120591620 GGTGGAGGGAAGAGGGAAGAAGG - Intronic
1090268423 11:125369417-125369439 AGGGAAGGGCAGAGGGAAGGAGG - Intronic
1090761469 11:129840415-129840437 AGTGCAGGGAGGAGGGAAGCCGG + Intronic
1091361041 11:134978606-134978628 AGGGAAGGGCAGAGGGAGGGAGG + Intergenic
1091390394 12:122695-122717 CGTGCAAGGGACAGGGAAGCTGG + Intronic
1092173568 12:6388339-6388361 CAAGAAGGGCAGAGGGGAGGAGG - Intronic
1092218721 12:6699317-6699339 CGGGAAGGGCGTGGGGAAGCAGG + Intronic
1092259614 12:6946051-6946073 CTGGAAAGGCAGAGGGAATCAGG - Intergenic
1092270267 12:7018240-7018262 CGCGAGGGGCGGAGGGAGGCAGG + Intronic
1092455029 12:8635469-8635491 GGTGAAGGGCTGAAGGGAGCAGG + Intergenic
1092508076 12:9124773-9124795 CATGAATGGCAGCGGGAGGCAGG + Intergenic
1092600726 12:10060548-10060570 GGTGAAGGCAAGAGGGAAGTGGG + Intronic
1092984456 12:13832001-13832023 GGTGAAGGGCAGTGGGGGGCAGG + Intronic
1094486109 12:30926923-30926945 CCGGGCGGGCAGAGGGAAGCCGG + Intronic
1096602843 12:52742460-52742482 CATGAATGGCAGTGGGAGGCAGG + Intergenic
1096982413 12:55736112-55736134 TGTGAGGGGCAGAAGGAGGCTGG - Intergenic
1097202703 12:57293031-57293053 AGCAAAGGACAGAGGGAAGCTGG + Intronic
1097287556 12:57889496-57889518 CCTGAGGCCCAGAGGGAAGCAGG + Intergenic
1097288327 12:57894478-57894500 TGTGAATGGCTGAGGGAAGCTGG + Intergenic
1097534808 12:60854920-60854942 CGTGGAGGGCCTAAGGAAGCTGG + Intergenic
1097861715 12:64524406-64524428 CTTGGAGGACAGAGGGAAGAGGG - Intergenic
1097918251 12:65042639-65042661 CTGGAGGGGCAGAGGGGAGCAGG - Intergenic
1098100205 12:67007141-67007163 GGTGATGGGCAGAGGGTAGAGGG + Intergenic
1100616475 12:96235235-96235257 CAAGAAGGGCAGGGGGAAGGAGG - Intronic
1101958624 12:109231704-109231726 GGTGAAGTCCAGAGGAAAGCAGG + Intronic
1102527044 12:113519797-113519819 CCAGAAGGGCAGAGGGAAGGGGG - Intergenic
1103767605 12:123292435-123292457 AGTGGAGGGGAGAGGGAAGAAGG + Exonic
1103781137 12:123399427-123399449 GGAGATGCGCAGAGGGAAGCTGG - Intronic
1103898741 12:124292265-124292287 TAGGAAGGGCAGAGGGAAGAAGG - Intronic
1104948143 12:132426469-132426491 CGTGGAGGACAGAGAGAAGGCGG - Intergenic
1105068255 12:133218093-133218115 GGTGAAGGGCAAAGGGCAGAGGG + Intergenic
1105344562 13:19561051-19561073 CGAGCAGGGCGGTGGGAAGCTGG - Intergenic
1105534637 13:21254007-21254029 CGGGAAGGAGAGAGGGAAGAGGG + Intergenic
1106129952 13:26931909-26931931 CTTTAAGGACAGAGGGAAGCTGG - Intergenic
1106460122 13:29961107-29961129 AGTGAAGGGATGAGTGAAGCTGG + Intergenic
1106682089 13:32018419-32018441 CGAGATGGGAGGAGGGAAGCAGG + Intergenic
1107951862 13:45469987-45470009 CGAGCAGGGGAGAGGGAAGAAGG + Intronic
1108286498 13:48914484-48914506 CAGCAAGGGCAGAAGGAAGCAGG - Intergenic
1109675954 13:65675800-65675822 CATGAAGGGCAAGTGGAAGCAGG - Intergenic
1109821627 13:67664629-67664651 CCTGAAGGGCAGAGAGAAGAGGG + Intergenic
1110308406 13:74017795-74017817 AGTGAAAGGCACAGAGAAGCAGG + Intronic
1111880864 13:93955191-93955213 AGTGAAGTGCAGAAGGAAGTTGG + Intronic
1112338915 13:98536921-98536943 AGTGAAAGGGAGGGGGAAGCAGG + Intronic
1113307240 13:109091685-109091707 GGTGAAGGGGAGAGGAAAGGAGG - Intronic
1114397976 14:22384063-22384085 AGTGAAGGGCAGAAGGAGTCTGG + Intergenic
1115271865 14:31561557-31561579 GCTGCAGGGCAGGGGGAAGCGGG + Intronic
1115418830 14:33168753-33168775 CGTGAATGGCAGAAGGAAGAGGG - Intronic
1117441865 14:55767369-55767391 AGTGAAGGGCAGAGCGAAGTTGG + Intergenic
1117517407 14:56515408-56515430 AGAGAAGTGCAGAGTGAAGCAGG - Intronic
1117609326 14:57465919-57465941 AATGAAGGGCAGGGGGCAGCAGG + Intergenic
1118762367 14:68888423-68888445 CGTGACGGGCAGAGTGGAGGAGG - Intronic
1119986348 14:79142437-79142459 AGTAAAGGGCAGACAGAAGCTGG + Intronic
1121747403 14:96308828-96308850 CTTGAAAGCCAAAGGGAAGCAGG - Intronic
1122063974 14:99158985-99159007 GGAGAAGGGCAGAGGGGACCTGG + Intergenic
1122232611 14:100314230-100314252 CGTGAAGGCCAGCTGGGAGCCGG + Intergenic
1122760470 14:104021127-104021149 GGTGAAAGGCAAAGGGAAGCTGG + Intronic
1122762232 14:104037780-104037802 GATGAAGGGAAGAGGAAAGCTGG - Intronic
1122848776 14:104515380-104515402 GGGGAAGGGCAGAGAGAAGTGGG + Intronic
1123156579 14:106233218-106233240 AGTGAAGGAGAGGGGGAAGCTGG - Intergenic
1123207351 14:106726331-106726353 AGTGAAAGAGAGAGGGAAGCTGG - Intergenic
1123215870 14:106808867-106808889 AGTGAAGGAGAGAGGGAGGCAGG - Intergenic
1123403592 15:20008032-20008054 TGGGAAGGGCACAGGGAAGGAGG - Intergenic
1123512928 15:21014677-21014699 TGGGAAGGGCACAGGGAAGGAGG - Intergenic
1124138791 15:27059114-27059136 CCTGAATGGCAGAGGGCACCAGG - Intronic
1124658405 15:31526457-31526479 CCTGACTGGCAGAGGGGAGCCGG + Intronic
1124659375 15:31533207-31533229 CGTGTAGGCCAGAAGGAAGCAGG + Intronic
1125049442 15:35279634-35279656 GGTGAAAGGCAAAGGGGAGCAGG - Intronic
1126249876 15:46554993-46555015 AGAGAAGTGCAGAGTGAAGCAGG + Intergenic
1126776472 15:52104709-52104731 GTAGAAGGGCAGATGGAAGCAGG + Intergenic
1127053157 15:55105856-55105878 GGAGAAGTGCAGAGTGAAGCGGG + Intergenic
1127599256 15:60518777-60518799 AGTGAAGGGGAGAGGGATGTGGG - Intronic
1129331578 15:74830537-74830559 CCTGAAGGGTAGAGTGAAGATGG - Exonic
1131024776 15:89130975-89130997 AGTGAAGGACAGAAGGAAGGAGG - Intronic
1131464737 15:92646025-92646047 CCTGAAGGGCATAGAGAAGGGGG - Intronic
1131627993 15:94144641-94144663 GGTGGAAGGCAAAGGGAAGCTGG - Intergenic
1132107829 15:99076817-99076839 GGTGAAGGACGGAGGCAAGCAGG - Intergenic
1132467586 16:84595-84617 CCTGCAGGGCAGAGGGAATTCGG + Intronic
1132513293 16:354299-354321 CCTGAAGGGCTGTGGGCAGCAGG - Intergenic
1132676109 16:1121885-1121907 TGTGAGGGGCACAGGGATGCTGG + Intergenic
1133138882 16:3730333-3730355 AGTGAAAGGCTGAGGGAGGCCGG + Intronic
1133435417 16:5775306-5775328 CTTGAAGGGAAGAGGGAAGAGGG - Intergenic
1134176747 16:12013060-12013082 GTTGGAGGGCAGAGTGAAGCAGG + Intronic
1135264250 16:21008734-21008756 AGTGATGGGGAGAGGAAAGCAGG - Intronic
1135295689 16:21277705-21277727 AGGGAAGGGCAGAGGGATGCGGG - Intronic
1136298956 16:29320572-29320594 AGTTCAGGGCAGAGGGAAGTTGG + Intergenic
1136385239 16:29921377-29921399 CGTGAGGTGCAGAGGGAACCTGG + Intronic
1137460468 16:48656688-48656710 CGAGAAGTGCAGAGTGAAGCGGG - Intergenic
1137785105 16:51132102-51132124 CGTGAAGGGCAGATGGACAGAGG - Intergenic
1138598680 16:58042615-58042637 AGGCAAGGACAGAGGGAAGCAGG - Intronic
1138659050 16:58507177-58507199 TGTGAGGGGCAGAGGGGAACAGG + Intronic
1139284168 16:65796029-65796051 CAATAAGGGCAGAGAGAAGCAGG - Intergenic
1139911995 16:70403222-70403244 GGGGAAGGGAAGAGGGGAGCAGG + Intronic
1140154287 16:72406628-72406650 CTTAAAGTGCTGAGGGAAGCAGG + Intergenic
1140209656 16:72960194-72960216 CCTGAAGGGCAGAGGCAAGGGGG + Exonic
1140269027 16:73446393-73446415 GGAGAAGTGCAGAGTGAAGCTGG + Intergenic
1141339130 16:83186895-83186917 GGTGAAGGGCAGATGGGAGACGG + Intronic
1141361869 16:83402948-83402970 CCTGAAGGGCAGATTGTAGCTGG - Intronic
1141713997 16:85716559-85716581 AGGGAAGGGGAGAGGGAAGGAGG + Intronic
1141841858 16:86578800-86578822 GGCGAAGGCCAGAGGGAGGCCGG - Exonic
1142251257 16:88993112-88993134 CGAGAGGGGGACAGGGAAGCTGG - Intergenic
1142958198 17:3535297-3535319 GGAGAAAGGAAGAGGGAAGCAGG - Intronic
1143165039 17:4893395-4893417 CGTGAGGGGCAGGGAGAAGCTGG - Intronic
1143687979 17:8534535-8534557 AGAGAAGGGCAAATGGAAGCAGG - Intronic
1143916196 17:10295180-10295202 CTAGAAGAGCAGAGGGAAGGAGG - Intergenic
1143918395 17:10311801-10311823 CGTGTGGGGCAGTGGGAAGGAGG + Intronic
1144256619 17:13474723-13474745 CGGTAAATGCAGAGGGAAGCAGG + Intergenic
1146064208 17:29622404-29622426 CTTGAAGGGCACACGGATGCTGG - Intronic
1147132105 17:38415630-38415652 CGGGGAGGGCAGTGGGCAGCAGG - Intergenic
1147157115 17:38549587-38549609 GGTGAGGGGCAGTGGGAAGGAGG - Intronic
1147224858 17:38968532-38968554 GGAGAAGGGCTGAGGGAAGAGGG + Intergenic
1148371118 17:47100393-47100415 CAGAAAGGGGAGAGGGAAGCTGG + Intergenic
1149085334 17:52709832-52709854 CGTCAAGAGCACAGGGAGGCTGG - Intergenic
1149539925 17:57461149-57461171 GGTCAAGGGCAGGGAGAAGCCGG - Intronic
1150319323 17:64198443-64198465 CATGAAGGGCGGGGGGAAGTTGG + Intronic
1151018131 17:70580682-70580704 GGTGGAAGGCAAAGGGAAGCAGG - Intergenic
1151541032 17:74764618-74764640 GGTGAAGGGGTGGGGGAAGCAGG - Intronic
1151670448 17:75569154-75569176 CAGGAAGGGCAGAGGCCAGCTGG + Intronic
1152078670 17:78173328-78173350 AGCGAAGGGGAGAGGGAGGCTGG + Exonic
1152207277 17:78980867-78980889 GGGGCAGAGCAGAGGGAAGCAGG + Intergenic
1152469027 17:80480822-80480844 CGGGAAGGGCTGAGGCAAGTGGG - Intergenic
1153362770 18:4216177-4216199 GGAGAAGTGCAGAGTGAAGCTGG + Intronic
1154499452 18:14987975-14987997 CCTGCAGGGCAGAGGGGAGGTGG + Intergenic
1155316755 18:24579334-24579356 AGTGAAGTGCAGTGGAAAGCAGG + Intergenic
1156347225 18:36268818-36268840 AGTCAAAGGCAGAAGGAAGCAGG - Exonic
1156476986 18:37411744-37411766 CGAGAAGGGCAGTGGCAGGCAGG + Intronic
1156514563 18:37669209-37669231 CAGAAAGGGCAGAGGGAAGTGGG - Intergenic
1156883008 18:42103136-42103158 CAAGAAGGGCAGATGGAGGCCGG + Intergenic
1157408098 18:47440680-47440702 CTTGAAGGGCAGAGTGGGGCAGG + Intergenic
1157500043 18:48183925-48183947 TGTCAAGGAGAGAGGGAAGCAGG - Intronic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1158851024 18:61495996-61496018 GGTGGAGGGGAGAGGGAAGAAGG - Intronic
1160172530 18:76566902-76566924 TGTGAAGGCCAGAGGGAAGCAGG - Intergenic
1160394508 18:78562110-78562132 TGGGAAGGGCAGAGGGATGGAGG - Intergenic
1161401896 19:4069577-4069599 AGTGAAGGGCAGAGGTCAGGAGG - Intergenic
1163122784 19:15227959-15227981 GTTGAAGGGAGGAGGGAAGCAGG - Intronic
1163427220 19:17246118-17246140 GGGGAGGGGCAGAGGGAGGCGGG - Intronic
1163595096 19:18216694-18216716 CGGGAGGGGCAGAGGGGAGCGGG - Intronic
1164222053 19:23203827-23203849 CGGGAAGGACAGAGGGACCCAGG - Intergenic
1164905208 19:31961454-31961476 AGTGATGGGGAGAGGGATGCTGG + Intergenic
1165087841 19:33363734-33363756 TGTCTAGGGCAGAGGGAAGTGGG - Intergenic
1165346209 19:35250010-35250032 GGTGAATGGCAAAGGGAAGAGGG + Intronic
1165362950 19:35347981-35348003 CGAGAAGCGGAGAGGGGAGCTGG - Intergenic
1165773084 19:38389499-38389521 CGGGAAGGGAAGAGGGAGGAAGG + Intronic
1165877183 19:39016377-39016399 CGTGAGGGGCTGGGGGAAACGGG + Intronic
1166256176 19:41606444-41606466 CCTGAAGGGCAGTGTGAAGAAGG + Intronic
1166332996 19:42089495-42089517 CGGCCAGGGCAGATGGAAGCGGG - Intronic
1166631634 19:44412117-44412139 GGGGAAGGCCAGAGAGAAGCTGG - Intergenic
1166636542 19:44456504-44456526 GGGGAAGGCCAGAGAGAAGCTGG + Intergenic
1166698501 19:44867972-44867994 AGTGGGGGGCAGAGGGAAGCGGG + Intronic
1167421141 19:49404118-49404140 GGTGAAGGGCAGAGGAAGGACGG - Intronic
1167444223 19:49528028-49528050 CGTGGAGAGCGGAGCGAAGCTGG + Exonic
1167592408 19:50411272-50411294 TGTGAAAGGCAGAGGGGAGTTGG - Intronic
1168063204 19:53905701-53905723 AGTGAAGGACAGAGGGAGGTCGG - Intronic
1168076911 19:53985519-53985541 CGTGGAGAGAAGAGGGATGCCGG + Exonic
1168121201 19:54253495-54253517 TGGGAAGGGCTGAGGGTAGCAGG + Intronic
925066035 2:929425-929447 CCTGAAGGGCACCAGGAAGCCGG + Intergenic
925119892 2:1409998-1410020 CGTGAGGGGCAGAAAGATGCTGG + Intronic
926224176 2:10955556-10955578 GGTGCAGGGCAGGAGGAAGCAGG - Intergenic
926750608 2:16196013-16196035 GGGGAAGGGCAGAGGGCAGCTGG - Intergenic
926939478 2:18119621-18119643 CGTGCAGGACAGAGGGAGGAAGG - Intronic
927289555 2:21392608-21392630 GGCTAAGGGGAGAGGGAAGCAGG - Intergenic
927514754 2:23665675-23665697 GGTGGAGAGCAGAGGGGAGCAGG + Intronic
927673291 2:25087106-25087128 GGAGAAGTGCAGAGTGAAGCAGG + Intronic
928108210 2:28486477-28486499 TCTGCAGGGCAGTGGGAAGCTGG + Intronic
929599651 2:43197192-43197214 GGTGAGGGGCAAAGGGGAGCAGG - Intergenic
930024125 2:47020139-47020161 AGTGAAGGGCTGTGGGGAGCGGG + Intronic
930204219 2:48572220-48572242 AGAGGAGGGCAGTGGGAAGCAGG + Intronic
931590220 2:63874843-63874865 AGTGGAAGGCAGAGGGGAGCTGG - Intronic
931716420 2:65032540-65032562 GATGAAGGGCAGCTGGAAGCGGG + Intergenic
933326906 2:80849513-80849535 CATGAATAGCAGAGGGTAGCTGG + Intergenic
933537180 2:83590772-83590794 TTTGAAAGGCAGAGGGAAGAGGG + Intergenic
934039186 2:88113931-88113953 GGTGAAGGGTTGAGGCAAGCAGG + Intergenic
934307377 2:91838661-91838683 AGAGAAGGGCAGAGGGAAAGGGG + Intergenic
934325880 2:92014052-92014074 AGAGAAGGGCAGAGGGAAAGGGG - Intergenic
934513864 2:94971861-94971883 AGTGAAGGAGAGAGGGAGGCAGG - Intergenic
935673382 2:105574125-105574147 CCTGCAGAGCAGAGGGAAGGTGG - Intergenic
935708130 2:105873816-105873838 AGTGAAGGGCAGAGGTGAGCAGG - Intronic
935976876 2:108586902-108586924 AGTGGAAGGCAGATGGAAGCTGG - Intronic
936939020 2:117863715-117863737 AGTGAAGGGCACAGGGCAGTAGG - Intergenic
937257243 2:120564282-120564304 CGAGGCGGGCAGAGGGAAGGAGG + Intergenic
937340181 2:121086248-121086270 GGTGAGGGGCAGAAGGAAGGGGG + Intergenic
938197920 2:129347671-129347693 CGTGAAGTGCAGACAGAAGAGGG - Intergenic
938498656 2:131818343-131818365 CCTGCAGGGCAGAGGGGAGGTGG + Intergenic
938949953 2:136246238-136246260 AGGGAGAGGCAGAGGGAAGCCGG + Intergenic
940078916 2:149778041-149778063 CTTGAAGGACATAGGGAAACAGG + Intergenic
940321961 2:152386956-152386978 GGTGAAGGGCAAGGGGAATCTGG - Intronic
940578655 2:155549082-155549104 GGAGAAGGGCAGAGTGAAGTGGG + Intergenic
940586491 2:155658486-155658508 GGGGAAGGGGAGAGGGAAGGGGG + Intergenic
940849161 2:158672003-158672025 CTTGAGGAACAGAGGGAAGCCGG + Intronic
941478670 2:165978376-165978398 CTAGAAGGGTAGAGGGAAGTAGG + Intergenic
941977601 2:171423095-171423117 GGAGAAGTGCAGAGTGAAGCAGG - Intronic
942187773 2:173440621-173440643 TGTGAAGGGCAGGGGGTAGGGGG - Intergenic
942866967 2:180688119-180688141 GGGGAAGGGCAGACGGAAGAGGG + Intergenic
943563880 2:189495157-189495179 GGAGAAGTGCAGAGCGAAGCAGG - Intergenic
943901378 2:193442075-193442097 GGAGAAAGGCAGAAGGAAGCTGG - Intergenic
943936296 2:193920367-193920389 GGAGAAGTGCAGAGTGAAGCGGG - Intergenic
944261618 2:197684196-197684218 TGAGAAGGGTAGAGGGAAGTGGG + Intergenic
945218887 2:207464415-207464437 TGTGAGGGGGTGAGGGAAGCAGG + Intergenic
946015894 2:216603399-216603421 CTTGAAGGTCAGAGGGGAACTGG + Intergenic
946229298 2:218281910-218281932 CTGGAAGGGCAGATGGAAGGTGG - Intronic
946359281 2:219209395-219209417 CCTGGAGGGCAGAGACAAGCGGG + Exonic
946418211 2:219551132-219551154 TGAGATGGGCAGAGGCAAGCTGG + Intronic
947035993 2:225856499-225856521 CATGAAGGCCAGAAAGAAGCAGG - Intergenic
947394912 2:229676802-229676824 CATGAAATGGAGAGGGAAGCAGG - Intronic
947671053 2:231935474-231935496 TGTGCAGGGCAGAGGCCAGCAGG - Intergenic
947840915 2:233207509-233207531 CGAGGAGGGCACAGGGAACCTGG - Exonic
948116244 2:235495606-235495628 CCTGACATGCAGAGGGAAGCGGG - Intronic
948311640 2:236991568-236991590 CAAGAAGGGCAGAGTGAAGTGGG - Intergenic
948371776 2:237494215-237494237 GGTGGAGGGCAGAGGGCAGAAGG + Intronic
948386937 2:237586301-237586323 CATGGGGTGCAGAGGGAAGCAGG - Intronic
948388932 2:237598306-237598328 GGAGAAGGGGAGAGGGAACCAGG - Intronic
948695151 2:239729521-239729543 CGGGTGGGGCAGAGGGAGGCGGG + Intergenic
1169563429 20:6826751-6826773 GGTGAAGGGTAGAGGGAATGGGG + Intergenic
1169870094 20:10240572-10240594 GGAGAATGGCAGAAGGAAGCAGG - Intronic
1170055345 20:12196814-12196836 TGTGAAGTGGTGAGGGAAGCTGG + Intergenic
1170441741 20:16386291-16386313 TGGAAAGGGCAGAGGGAAGAGGG + Intronic
1170926352 20:20727944-20727966 CTGGAAGGACAGAGGGAAGAGGG + Intergenic
1171271640 20:23822888-23822910 GGTGGAGGGAAGAGGGCAGCAGG - Intergenic
1172245679 20:33443689-33443711 CGCCCAGGGCAGAGGGCAGCGGG + Exonic
1172386976 20:34540876-34540898 ACTGAAGGTCAGAAGGAAGCTGG - Exonic
1172480414 20:35268035-35268057 TGTGAGGGGGAGAAGGAAGCAGG + Intronic
1172611288 20:36254508-36254530 CCTGGAGGGAAGAGGGAAGGGGG + Intronic
1173305216 20:41841290-41841312 AGGGAAGGACAGAGGGAGGCAGG - Intergenic
1173401890 20:42733493-42733515 CGAGAAGGGCAGCAGGAAGTGGG - Intronic
1173721032 20:45258374-45258396 TGGGAAGTGCAGAGGCAAGCAGG - Intergenic
1174530654 20:51210739-51210761 GGAGAAGTGCAGAGCGAAGCAGG - Intergenic
1174685989 20:52455651-52455673 GGTGAAAGGCAGATGGGAGCTGG + Intergenic
1174964499 20:55196698-55196720 AGAGAAGGGCAGAGTGAAGGTGG - Intergenic
1175390815 20:58626186-58626208 AGTGAAGGGCAGAGGGACAGTGG + Intergenic
1175454975 20:59105699-59105721 TGGGAAGGGCAGTGGGAGGCTGG - Intergenic
1175536252 20:59716181-59716203 GGTGAAGGGAAGAGCAAAGCAGG - Intronic
1175658073 20:60789377-60789399 GGTGAAAGGCAGAAGGTAGCTGG + Intergenic
1176028577 20:62999075-62999097 GGGGAAGGGGAGAGGGAAGAGGG + Intergenic
1176090002 20:63314539-63314561 TGGGAAGCCCAGAGGGAAGCTGG - Intronic
1176093975 20:63331173-63331195 CGTGAGGCGCAGAGAGAGGCGGG - Intronic
1177283753 21:19021098-19021120 GGAGAAGGTCAAAGGGAAGCAGG - Intergenic
1177769825 21:25502096-25502118 GGAGAAGTGCAGAGTGAAGCTGG + Intergenic
1177924779 21:27200270-27200292 GGTGAAAGGCAAAGGGGAGCAGG - Intergenic
1178144949 21:29728456-29728478 AGTGAAGGGCCAAGGGATGCAGG + Intronic
1178359205 21:31933873-31933895 CATGGAGGGGAGAGGGAAGTGGG - Intronic
1178614713 21:34122088-34122110 TGTGATGGGCTGAGGGAAGCTGG - Intronic
1178689479 21:34739342-34739364 TGTGAAGGTCAGAGGGAAGGAGG - Intergenic
1179130930 21:38636567-38636589 GGTGAAGAGCAGATGAAAGCTGG + Intronic
1179437680 21:41373569-41373591 GCTGAAGGGCAGAGGGGAGTTGG - Intronic
1179518918 21:41929426-41929448 CGTGCAGGGCTGTGGGAAGCAGG - Intronic
1180170301 21:46054982-46055004 TGTGCAGGGCAGAGGGAGGCAGG - Intergenic
1180170310 21:46055009-46055031 TGTGCAGGGCAGAGGGAGGGAGG - Intergenic
1180170339 21:46055091-46055113 TGTGCGGGGCAGAGGGAGGCAGG - Intergenic
1180231531 21:46429437-46429459 CGTGAGGGGCACAGGGGGGCCGG + Intronic
1180278144 22:10664993-10665015 AGAGAAGGGCAGAGGGAAAGGGG - Intergenic
1180338481 22:11599881-11599903 AGAGAAGAACAGAGGGAAGCAGG - Intergenic
1180585393 22:16883846-16883868 AGAGAAGGGCAGAGGGAAAGGGG - Intergenic
1180715758 22:17871166-17871188 CGTGATGGGCAGAGGCAGGCTGG - Intronic
1180770618 22:18381567-18381589 GGTGAAGGGCAAGGGGAGGCAGG - Intergenic
1180828561 22:18884525-18884547 GGTGAAGGGCAAGGGGAGGCAGG - Intergenic
1181363693 22:22357799-22357821 GGTGAGGAGGAGAGGGAAGCCGG - Intergenic
1181366507 22:22380884-22380906 GGTGAGGAGGAGAGGGAAGCTGG - Intergenic
1181647320 22:24239503-24239525 AATGTAGGGTAGAGGGAAGCAGG + Intronic
1182429740 22:30292566-30292588 GATGAAGGGGAGAGGGCAGCTGG - Exonic
1182667458 22:31970335-31970357 TGTGAAGAGCAGCGGGATGCGGG + Intergenic
1182779986 22:32859768-32859790 GGAGAAGGGCAAAGGGAAGAGGG - Exonic
1183349983 22:37329691-37329713 CGTGCAGGGAAGAAGGAAGAGGG + Intergenic
1183535318 22:38397966-38397988 CGGGAAGGGCCGGGGGAAGTTGG - Intronic
1183544612 22:38448890-38448912 CCAGCAGGGCAGAGGGGAGCTGG - Intronic
1183688414 22:39375025-39375047 TCTGAAGGGCAAAGGGCAGCAGG - Intronic
1183992633 22:41608577-41608599 CCTGCAGGGCAGAGTGAAGGGGG + Intronic
1184412911 22:44336289-44336311 GGTGAAGGGCGGAGGGAGGGAGG - Intergenic
1203232453 22_KI270731v1_random:122739-122761 GGTGAAGGGCAAGGGGAGGCAGG - Intergenic
949809375 3:7989771-7989793 AGTAAAGGTCAGAGGGAACCAGG + Intergenic
950483091 3:13256803-13256825 CGAGAAGGGGAGAGGGACCCTGG + Intergenic
950532939 3:13563544-13563566 GGAGAAGGGCAAAGGAAAGCAGG - Intronic
950656544 3:14440440-14440462 GGAGAAGGGGAGAGGGAAGATGG + Intronic
951837368 3:26998048-26998070 AGTGAAGGAGAGAGGGAAGGGGG - Intergenic
952843862 3:37670333-37670355 TGTGATGGACAGAGGGAAGGAGG - Intronic
953565604 3:44029243-44029265 GGCCAAAGGCAGAGGGAAGCTGG + Intergenic
954378724 3:50208202-50208224 CGAGAAGGGGAGAGGGAGCCAGG - Intronic
954386886 3:50248812-50248834 CTTGAAGGGGACAGGGAAGTGGG + Intronic
954468328 3:50671163-50671185 CCAGAAGGGCAGAGGTAAGTTGG + Intergenic
954581156 3:51703578-51703600 GGTAGAGGGCAGAGGGCAGCTGG + Intronic
954676697 3:52319802-52319824 TGTGAAGGGCTGAGGGATGGAGG + Intronic
955055461 3:55451340-55451362 CGAAAAGTGCAGAGTGAAGCAGG + Intergenic
960596514 3:119412511-119412533 CTAGAAGGACAAAGGGAAGCTGG + Intronic
961468406 3:127096012-127096034 AGTGAAATGCAGAGGAAAGCAGG - Intergenic
961556229 3:127698209-127698231 GGTGAGGGGCAGAGGGAAACTGG + Intronic
961815903 3:129550035-129550057 TGTGAAGGGCAGCTGGAATCAGG + Intronic
962344031 3:134606822-134606844 CGTGGAGGGGAGAGGGGAGGAGG - Intronic
962397967 3:135034291-135034313 CATGAAGGTCTGAGGGAGGCAGG - Intronic
962629142 3:137258393-137258415 TTTGAAGGGAAGATGGAAGCAGG + Intergenic
965781124 3:172287150-172287172 CATGAAGGGCACAGCAAAGCTGG - Intronic
966074139 3:175916274-175916296 AGAGAAGTGCAGAGGGAATCAGG + Intergenic
968488929 4:879759-879781 CAGAAAGGGAAGAGGGAAGCGGG - Intronic
968540989 4:1168329-1168351 CGTGCACGGCAGAGTGAGGCGGG - Intronic
968713991 4:2141067-2141089 AGGAAAGGGCAGAGAGAAGCTGG + Intronic
968903551 4:3441965-3441987 CCTGAGGGGCAGTGGGAGGCGGG - Exonic
968958664 4:3731630-3731652 GGTGAAGTCCAGAGGCAAGCTGG + Intergenic
968979396 4:3838582-3838604 AGTGAGGGACAGAGGGAAGAGGG + Intergenic
969117653 4:4881958-4881980 CTTGAGGGGCAGAGGGAACCTGG - Intergenic
970755950 4:19427374-19427396 TGTGAAAGGCAGAAGGAAGTAGG - Intergenic
971309741 4:25515051-25515073 GGAGGAGAGCAGAGGGAAGCGGG + Intergenic
972203883 4:36747872-36747894 CATGAATGGCAGTGGGAAGCAGG + Intergenic
972640023 4:40916901-40916923 GGGGAAGGTCAGAGGGAAGAGGG + Intronic
973281021 4:48361480-48361502 TCTTAAGGGCAGAGGGAAACTGG + Intronic
974832757 4:67210025-67210047 GGAGAAGTGCAGAGTGAAGCGGG - Intergenic
974877484 4:67716673-67716695 CGTGAAGATCAGAGTGAAACAGG - Intergenic
975607334 4:76168282-76168304 CCTGAAGGGCAGGGGTGAGCAGG + Intronic
976364838 4:84221830-84221852 TGTGAAATGCAGAGGGAAGTGGG + Intergenic
976851376 4:89550018-89550040 CATGAAGGGCAAAGGGCATCAGG - Intergenic
977828070 4:101556991-101557013 AGAGAAGTGCAGAGGGAAGGGGG + Intronic
979439401 4:120733631-120733653 CCAGAAGGGGAGTGGGAAGCTGG - Intronic
980220298 4:129904184-129904206 CCTGAAGGGCAGATGCAGGCAGG - Intergenic
980654478 4:135765054-135765076 GGAGAAGAGCAGAGTGAAGCAGG + Intergenic
981666349 4:147231209-147231231 AGTGAAGGGAAGAGGGAGACAGG - Intergenic
982566098 4:156988852-156988874 AGAGAAGTGCAGAGTGAAGCAGG - Intergenic
982740772 4:159054743-159054765 GGTGGAGGACAGAGGCAAGCAGG - Intergenic
983124907 4:163938795-163938817 GGAGAAGCGCAGAGTGAAGCAGG + Intronic
983298160 4:165892083-165892105 GGAGAAGTGCAGAGTGAAGCAGG + Intronic
983847286 4:172536072-172536094 AGAGAAGTGCAGAGCGAAGCGGG - Intronic
984417360 4:179478353-179478375 CATTAAGGGCAGTGGGAAGCAGG + Intergenic
984918417 4:184743482-184743504 AGGGGAGGGCAGAGGGAAGAGGG + Intergenic
985385353 4:189440705-189440727 AGGGAAGGACAGAGGAAAGCAGG - Intergenic
985783759 5:1883782-1883804 CGCGAGGGGCAGGGGGAAGCCGG - Intronic
985938659 5:3116358-3116380 CGGGCAGTGCAGGGGGAAGCAGG - Intergenic
986185940 5:5438154-5438176 AGAGAAGTGCAGAGCGAAGCGGG + Intronic
986807082 5:11318179-11318201 AGTGATGGACAGAGGGAAGGTGG - Intronic
987369706 5:17181879-17181901 GGAGAAGGGCAGTGGGAAGCTGG - Intronic
990632544 5:57686434-57686456 GGTGTGGGGCAGAGGGTAGCAGG - Intergenic
991559542 5:67934988-67935010 TGTGAAGGACAGAAGGAAGAAGG + Intergenic
994214974 5:97127533-97127555 AATGAAGTGCAGAGGGAAGAAGG + Intronic
995235982 5:109831000-109831022 GGTGAAGGGCACAGGGATGGGGG + Intronic
995265039 5:110150073-110150095 TGGGAAGGGTAGAGGGAAGTGGG - Intergenic
995425220 5:112013767-112013789 AGTGAAGTGCTGAGGGGAGCAGG + Intergenic
995484920 5:112630369-112630391 CCTGAAGGGAAGAGGTAAGGTGG - Intergenic
995683382 5:114745098-114745120 TGTGCAGGGCAGAGGGACCCTGG - Intergenic
997883381 5:137610621-137610643 CATGAAGGGATGAGGGAAGCAGG - Intergenic
998024598 5:138804475-138804497 CTTGCTGGGCAGTGGGAAGCAGG - Intronic
998127356 5:139633711-139633733 CGGGGAGGGCAGAGGGGAGCTGG - Intergenic
998813683 5:145991473-145991495 AAAGCAGGGCAGAGGGAAGCAGG - Intronic
999023743 5:148201224-148201246 CTTGAAGATCAGAGGAAAGCAGG + Intergenic
999385033 5:151148014-151148036 CCTGAAGGGCTGGGGGCAGCTGG - Intronic
1000822955 5:166007993-166008015 GCTGGAGGGCAGAGGGAAGAGGG - Intergenic
1001489956 5:172148303-172148325 GGTGGGGGGCAGAGGGAAGCAGG + Intronic
1001546999 5:172576450-172576472 TCCAAAGGGCAGAGGGAAGCAGG + Intergenic
1001585846 5:172833638-172833660 CGACAGGGGCAGATGGAAGCAGG + Intergenic
1002642723 5:180638099-180638121 TGTGTTGGGCAGAGGGGAGCTGG - Intronic
1003376655 6:5584542-5584564 CGGGAAGGAGAGAGGGAAGAGGG - Intronic
1003974101 6:11326656-11326678 CAGGAGGGGCAGAGGGAAGCTGG - Intronic
1006371926 6:33650150-33650172 GCTGAAGGGCAGAGAGAAGGAGG - Intronic
1006611965 6:35299445-35299467 TGTGAAGGGCAGAGAGAGCCTGG - Intronic
1007094184 6:39203343-39203365 AGTCAGGGGCAGAGGGAAACGGG + Intronic
1007182364 6:39938813-39938835 GGTAGAAGGCAGAGGGAAGCAGG + Intergenic
1007274514 6:40663531-40663553 AGTGAAGAGCCGAGGGAGGCAGG + Intergenic
1007414305 6:41683154-41683176 CGTGGAGAGCAGAGGGGAACTGG + Intergenic
1007451048 6:41940778-41940800 CGTCAAGGGGAGAGGGGAGGAGG - Intronic
1007511350 6:42376477-42376499 CCAGAAGGGCAGAGGGGAGAGGG + Intronic
1007535009 6:42579203-42579225 GCTGAAGGGGAAAGGGAAGCAGG + Intronic
1007745780 6:44042289-44042311 CTTGAAGTTCAGAGGGAACCTGG - Intergenic
1008549069 6:52610333-52610355 CCTGACAGGCAGAGGGAATCCGG + Intergenic
1010002828 6:70965317-70965339 AGAGAAGTGCAGAGTGAAGCAGG + Intergenic
1010313437 6:74416521-74416543 TGGGAAGGGTAGAGGGAAGGGGG - Intergenic
1011131913 6:84060331-84060353 TTAGAAGGGCAGAGGGAAGGGGG + Intronic
1011499820 6:87975752-87975774 AGAGAAAGGCAGAGGGAAACTGG - Intergenic
1011719858 6:90144333-90144355 TGGGAAGGACAGAGGGAAGGAGG + Intronic
1012263161 6:97111367-97111389 CGTGAAGGGGTCAGGGAATCTGG - Intronic
1012537759 6:100319845-100319867 TGTGAAGGGTAGTGGGGAGCAGG - Intergenic
1013074657 6:106760754-106760776 GTTGAAGGTAAGAGGGAAGCTGG + Intergenic
1013417181 6:109935515-109935537 GGAGAAGTGCAGAGTGAAGCAGG + Intergenic
1013968425 6:115984713-115984735 TGTGAATGGCAGAGGGAAACAGG - Intronic
1015376440 6:132515416-132515438 CGTGAGGGACAGAGAGAAGAGGG - Intergenic
1016350348 6:143160107-143160129 AGGGAAGGACAGAGGGAAGAGGG - Intronic
1016866630 6:148773946-148773968 CGGGGAGGACAGAGGGAAGCTGG - Intronic
1018204925 6:161428341-161428363 AGAGAGGGGCAGAGGGAGGCAGG + Intronic
1018633274 6:165838870-165838892 GGACAAGGGCAGAGGGAGGCTGG - Intronic
1019136354 6:169911119-169911141 GGGGAAGGGCAGAGGGGAGACGG + Intergenic
1019186725 6:170224780-170224802 AATGCAGGGCAGAGGGAAGCGGG - Intergenic
1019533429 7:1515165-1515187 AGTGCAGGGCAGATTGAAGCTGG + Intergenic
1019768594 7:2869518-2869540 GGTGAAGTGCTGAGTGAAGCGGG + Intergenic
1020055886 7:5117386-5117408 CCTGGAGGGCAGGAGGAAGCCGG - Intergenic
1020080216 7:5282789-5282811 GGTGAAGGGAGGAGGGAAGAGGG + Intronic
1022047948 7:26638343-26638365 CGAGAAGTGCAGAGGGAAGGAGG - Intronic
1022813398 7:33890864-33890886 GGAGAGGAGCAGAGGGAAGCAGG + Intergenic
1022831853 7:34075645-34075667 CGTGATAGGCAGAGGGAGGGAGG - Intronic
1023327471 7:39075645-39075667 CCTGAAGGCCACAGGGAGGCTGG + Intronic
1023466069 7:40456589-40456611 GGTCAAGGGAAGAGGGAATCAGG + Intronic
1023770001 7:43548526-43548548 AGTGGAGAGCAGAGGGATGCAGG + Intronic
1024097604 7:45996403-45996425 CATGAAGGGCAGAAGGAAGTGGG + Intergenic
1024194470 7:47045483-47045505 TCTGAAGGGCAGGGGGAAGGAGG + Intergenic
1025198699 7:56949408-56949430 GGTGAAGGGAGGAGGGAAGGGGG - Intergenic
1027961982 7:84957449-84957471 TGTCATGGGGAGAGGGAAGCGGG + Intergenic
1028214315 7:88113063-88113085 CGGGATGGGCCTAGGGAAGCAGG - Intronic
1028740733 7:94271464-94271486 AGAGAAGTGCAGAGGGATGCGGG + Intergenic
1030306671 7:108026108-108026130 CCTGAAGGGGCCAGGGAAGCAGG - Intronic
1031327714 7:120422661-120422683 GGTGGAGGGCAGACGGAAGAAGG - Intronic
1031521939 7:122777692-122777714 GGAGAAGTGCAGAGGGAAGTGGG - Intronic
1031563001 7:123260811-123260833 TGTAAAGGGCAGAAGGAAGTTGG - Intergenic
1031913910 7:127544847-127544869 CCTGAAAGGCAGGGAGAAGCGGG + Intergenic
1032116144 7:129118876-129118898 CTTGAAGGGCAGAGGGAAGTGGG - Intergenic
1032715651 7:134506969-134506991 GGTGGACTGCAGAGGGAAGCTGG + Intergenic
1033329702 7:140407841-140407863 AGTGAAGGTCAGAGGGCACCGGG + Exonic
1034780274 7:153873087-153873109 GGTGAAAGGTGGAGGGAAGCTGG + Intergenic
1034927921 7:155138190-155138212 TTTGAAGGGCAGAGGCAAGCAGG + Intergenic
1035587144 8:785491-785513 CCTGAGGGGAGGAGGGAAGCTGG - Intergenic
1035587154 8:785525-785547 CCTGAGGGGAGGAGGGAAGCCGG - Intergenic
1035587213 8:785692-785714 CCTGAGGGGAGGAGGGAAGCCGG - Intergenic
1036429709 8:8678826-8678848 AGAGAAGGGGAGAAGGAAGCTGG - Intergenic
1037819776 8:22130049-22130071 CGGGGAGGGGAGAGGGAAGGAGG + Intronic
1037981846 8:23259891-23259913 CTTCAAGGGCAGTGGGAATCAGG + Intronic
1038153959 8:24969844-24969866 TGGGAAGGGTAGAGGGAAGGAGG - Intergenic
1038350234 8:26769973-26769995 CGGGTAGGGCACAGGGAAGAGGG - Intronic
1038426655 8:27468324-27468346 GCTGAGGGCCAGAGGGAAGCAGG - Intronic
1039268375 8:35854006-35854028 CGAGAAGGAAAGAAGGAAGCGGG + Intergenic
1040042616 8:42931739-42931761 CGGGATGGGAAGAGGGAAGAGGG - Intronic
1040830061 8:51666314-51666336 GGTCAAGGGAAGAGGGAAGAGGG - Intronic
1041191888 8:55363357-55363379 CGTGAAAGGAAAAGGGAAACAGG + Intronic
1042271697 8:66962191-66962213 CGTGAAAGGCCGAGGGCGGCTGG - Intronic
1043697616 8:83240467-83240489 GGTGAAAGGCAAAGGGGAGCTGG - Intergenic
1044510936 8:93077688-93077710 TGTGAAGGGAAGAGGGAAAAGGG + Intergenic
1046404411 8:113754137-113754159 AGTGAAGTGCAGAGTGAAGTTGG - Intergenic
1049197930 8:141325644-141325666 CGTGAAGGGCACACGGGGGCTGG + Intergenic
1049414052 8:142487417-142487439 AGTGGAGGGCAGAGGGAATTCGG - Intronic
1051502832 9:17796537-17796559 TCTGAAGGGCACAGGGAAGGGGG + Exonic
1052387968 9:27844614-27844636 GGAGAAGTGCAGAGGGAAGTGGG + Intergenic
1052512076 9:29434869-29434891 TGTGAGGGGCAGAGGGAGACAGG - Intergenic
1052853654 9:33393618-33393640 CGTTAAGGGCAGAGGCTCGCTGG + Intronic
1053293133 9:36895177-36895199 CGAGAGGCGCAGAGGGAAGCAGG + Intronic
1053382026 9:37656720-37656742 CCTGAAGGACAGTGGGAAGCCGG + Intronic
1053694320 9:40621469-40621491 AGAGAAGGGCAGAGGGAAAGGGG - Intergenic
1053941310 9:43251875-43251897 AGAGAAGGGCAGAGGGAAAGGGG - Intergenic
1054270516 9:63018659-63018681 AGAGAAGGGCAGAGGGAAAGGGG + Intergenic
1054305565 9:63420693-63420715 AGAGAAGGGCAGAGGGAAAGGGG - Intergenic
1054404311 9:64744680-64744702 AGAGAAGGGCAGAGGGAAAGGGG - Intergenic
1054437933 9:65230177-65230199 AGAGAAGGGCAGAGGGAAAGGGG - Intergenic
1054492471 9:65791785-65791807 AGAGAAGGGCAGAGGGAAAGGGG + Intergenic
1054744707 9:68843018-68843040 CGTGAAGGGCAGAGGGAAGCTGG - Intronic
1055264650 9:74481040-74481062 TGTGAAGGCCAGAGGTAAGCAGG - Intergenic
1055921265 9:81463409-81463431 CCTGAAGGGGAAAGGGGAGCAGG - Intergenic
1056055320 9:82816904-82816926 AGTGAAGGGAAAAGGAAAGCAGG - Intergenic
1056772808 9:89492067-89492089 CGTGAAGGGCAGTGGGGAAGTGG - Intronic
1056837756 9:89971025-89971047 GGTGAAGGGCTGAGCGAAGTGGG + Intergenic
1056925000 9:90826908-90826930 TGTGTAGGGCAGAGGAAAGAAGG - Intronic
1057040065 9:91841665-91841687 TGTGGAGGGCAGAGGGACGAGGG - Intronic
1058842937 9:108927896-108927918 AGTGAGGGGCTGAGGGAAGTTGG + Intronic
1060984996 9:127814829-127814851 GGTGAATGGCAGAGGGGAACTGG + Intergenic
1061255396 9:129452185-129452207 CAGGAAGGGCAGAGAGAAGGCGG + Intergenic
1061873953 9:133534782-133534804 GGGGAAGGGGAGAGGGAGGCCGG + Intronic
1062191411 9:135249702-135249724 AGTGAAGGCCAAGGGGAAGCAGG - Intergenic
1062227779 9:135463197-135463219 AGTTTAGGGCAGAGGGGAGCTGG + Intergenic
1062254577 9:135614918-135614940 GGTGCAGGGCTGAGGGAAGTGGG + Intergenic
1185882161 X:3751097-3751119 GGAGAAGTGCAGAGTGAAGCGGG + Intergenic
1186608257 X:11113169-11113191 CGTGAAGGGCAGAAGCAACATGG + Intronic
1187473261 X:19588178-19588200 AGTGAAGAGCAGAGGGAGCCTGG + Intronic
1187474919 X:19602179-19602201 AGGGAGGGGCAGGGGGAAGCTGG - Intronic
1188302292 X:28519742-28519764 CGAGAAGTGCAGAGTGAAGGGGG - Intergenic
1188587591 X:31796917-31796939 GGTGAAGGGCAAAGGGGAGCTGG - Intronic
1188971853 X:36627446-36627468 TGGGAAGGGCAGTGGGGAGCTGG - Intergenic
1188972072 X:36630052-36630074 TGGGAAGGGCAGTGGGGAGCTGG - Intergenic
1189548642 X:42070490-42070512 CCTGTGGGGCAGAGGGGAGCAGG + Intergenic
1190234489 X:48605145-48605167 CGGACAGGGCAGAGGGCAGCGGG + Exonic
1190266782 X:48831652-48831674 TGGGAAGGGGAGAGGGAGGCGGG - Intronic
1190475414 X:50822171-50822193 TGGGAAGGGTAGAGGGAAGGGGG + Intergenic
1192315805 X:70050381-70050403 ATTGGAGGGCAGAGGGAAGGAGG + Intergenic
1192412554 X:70947257-70947279 GGTGGAAGGCAAAGGGAAGCAGG + Intergenic
1193473545 X:81935366-81935388 GGTGAAGGGCAAAGGGAAGCTGG - Intergenic
1195315406 X:103672632-103672654 TGTGATGGGCCGGGGGAAGCTGG + Intergenic
1196883190 X:120219002-120219024 TGTGAAGGGTAGAGGGAGGGAGG + Intergenic
1197707721 X:129646528-129646550 AGGGAAGGGCAGAAGGAAGGAGG - Exonic
1197962496 X:132022616-132022638 CGTGTAAGGCAGAGGGAAATTGG - Intergenic
1198312170 X:135434264-135434286 TGTGCAGGGCAGAGTGAATCAGG - Intergenic
1198460447 X:136858017-136858039 GGTGAAGGACAGAGAAAAGCAGG - Intronic
1198607583 X:138358843-138358865 TGTGAAGTGGAGAGGGAAGTGGG - Intergenic
1199544978 X:148998888-148998910 GGTGATGGACAGAGGGAAGGAGG - Exonic
1199874549 X:151920241-151920263 TGGGATTGGCAGAGGGAAGCCGG + Intronic
1200120185 X:153786476-153786498 GGTGGAGGGCAGAAGGATGCCGG + Intronic
1200163039 X:154019003-154019025 GGTGGAGGCCACAGGGAAGCAGG + Exonic
1200782809 Y:7232114-7232136 GGAGAAGTGCAGAGTGAAGCGGG - Intergenic
1201192129 Y:11453384-11453406 AGAGAAGGGCAGAGGGAAAGGGG - Intergenic