ID: 1054744730

View in Genome Browser
Species Human (GRCh38)
Location 9:68843192-68843214
Sequence GGCATAGGGTTCCCTGACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054744730_1054744738 -9 Left 1054744730 9:68843192-68843214 CCCCAGTCAGGGAACCCTATGCC No data
Right 1054744738 9:68843206-68843228 CCCTATGCCAGGGGAGGAATTGG No data
1054744730_1054744740 -8 Left 1054744730 9:68843192-68843214 CCCCAGTCAGGGAACCCTATGCC No data
Right 1054744740 9:68843207-68843229 CCTATGCCAGGGGAGGAATTGGG No data
1054744730_1054744743 14 Left 1054744730 9:68843192-68843214 CCCCAGTCAGGGAACCCTATGCC No data
Right 1054744743 9:68843229-68843251 GCCTCAGCATGGACAAGTCTTGG No data
1054744730_1054744745 29 Left 1054744730 9:68843192-68843214 CCCCAGTCAGGGAACCCTATGCC No data
Right 1054744745 9:68843244-68843266 AGTCTTGGCAAAGACCGCTATGG No data
1054744730_1054744742 3 Left 1054744730 9:68843192-68843214 CCCCAGTCAGGGAACCCTATGCC No data
Right 1054744742 9:68843218-68843240 GGAGGAATTGGGCCTCAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054744730 Original CRISPR GGCATAGGGTTCCCTGACTG GGG (reversed) Intronic