ID: 1054745225

View in Genome Browser
Species Human (GRCh38)
Location 9:68847386-68847408
Sequence ACTGCTGTTGTTGCTGATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 356}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054745225 Original CRISPR ACTGCTGTTGTTGCTGATTT AGG (reversed) Intronic
900967791 1:5971252-5971274 GTTGCTGTTGTTGTTGTTTTTGG - Intronic
901153876 1:7122683-7122705 AGGGCTGTTGTTGCTGAGTGTGG + Intronic
901424245 1:9171204-9171226 ATTGCTATTGCTGCTGTTTTTGG - Intergenic
902216113 1:14935463-14935485 ACTGCTGATGTTGCTGGTCCTGG - Intronic
902984454 1:20147145-20147167 GCTGCTGCTGTTGCTGGTTCAGG - Intronic
908692092 1:66793488-66793510 GCTGCTGTTGTTGTTTTTTTTGG - Intergenic
909068138 1:70961057-70961079 AATGCTGATGCTGCTGATCTGGG + Intronic
909347123 1:74603488-74603510 ATTGTTGTTATTGCTGCTTTAGG + Intronic
910215079 1:84835521-84835543 AATGCTGTTCTTGCTTGTTTTGG + Intronic
911384326 1:97156008-97156030 GATGCTGATGTTGCTGGTTTGGG + Intronic
911513478 1:98837923-98837945 ACTGCTTTTGAAGTTGATTTTGG + Intergenic
912141059 1:106727897-106727919 TTTGTTGTTGTTGTTGATTTTGG - Intergenic
913360942 1:117979264-117979286 GGTGCTGATGTTGCTGATATAGG - Intronic
913580173 1:120218844-120218866 ACTGCTCCTGGTCCTGATTTTGG + Intergenic
913628003 1:120679549-120679571 ACTGCTCCTGGTCCTGATTTTGG - Intergenic
913658664 1:120986647-120986669 ACTTCTGTTGTCACTGACTTTGG + Intergenic
914010029 1:143769772-143769794 ACTTCTGTTGTCACTGACTTTGG + Intergenic
914340382 1:146755135-146755157 ACTGCAGTTCTTGTTTATTTGGG + Intergenic
914562098 1:148830285-148830307 ACTGCTCCTGGTCCTGATTTTGG + Intronic
914610732 1:149299936-149299958 ACTGCTCCTGGTCCTGATTTTGG - Intergenic
914648647 1:149678430-149678452 ACTTCTGTTGTCACTGACTTTGG + Intergenic
915253689 1:154608956-154608978 ACTGCTGCTGTTGCTACTCTTGG - Intronic
918648198 1:186926378-186926400 ACTTTTGTTGTTGCTTTTTTTGG + Intronic
919359288 1:196570179-196570201 CTTGCTGTTGTTACTGTTTTTGG - Intronic
920224109 1:204425487-204425509 ATGGCTGTACTTGCTGATTTAGG - Intronic
920842239 1:209564648-209564670 ACTGCTGATGTTGCTGGTCCAGG - Intergenic
921361909 1:214337891-214337913 ACAGCTGTTCTAGCTGTTTTCGG - Intergenic
922131746 1:222787074-222787096 ACTCCTGTTGTTGAGGAATTGGG + Intergenic
924671954 1:246137657-246137679 AAGGCTGTGGTTGCTGAATTGGG - Intronic
1064538065 10:16378478-16378500 ACTGCAGTTGTTTATGATTGTGG + Intergenic
1064816412 10:19270022-19270044 ACTGCTGGTTTTGCTGAGTGTGG + Intronic
1064870632 10:19933323-19933345 ACTGCTCTAATTGGTGATTTGGG - Intronic
1066168284 10:32813085-32813107 GTTGTTGTTGTTGCTGTTTTGGG - Intronic
1066538986 10:36423657-36423679 GCTCCTGTTGTTGATGTTTTTGG - Intergenic
1067302112 10:45021406-45021428 AGTGTTGTTGTTGCACATTTTGG - Intergenic
1068268940 10:54694653-54694675 ACTACTATTGTAGTTGATTTGGG + Intronic
1068402140 10:56542329-56542351 ACTACTCTTGGTGATGATTTTGG - Intergenic
1071540672 10:86480514-86480536 ACTGTTATTTTAGCTGATTTTGG - Intronic
1072121715 10:92410707-92410729 TCTGCTGATGTGGCTGATTAAGG + Intergenic
1072863657 10:99033805-99033827 CCTGCTGTTGTTGCTGTTGTTGG - Intronic
1073223033 10:101892129-101892151 TTTGTTGTTGTTGTTGATTTTGG - Intronic
1073601457 10:104849978-104850000 GCTGCTGCTGCTGCTGATTTGGG + Intronic
1074390353 10:113052372-113052394 ACAGCTGTCATTGCTGTTTTAGG + Intronic
1075244431 10:120808178-120808200 ACTGCAGTTTGTGTTGATTTTGG + Intergenic
1076762565 10:132612615-132612637 CCTGCTGGTTTTGCTGATCTGGG + Intronic
1076801731 10:132834091-132834113 CCTGCGGTTGTTGCCGATTCAGG - Exonic
1077667255 11:4123827-4123849 ACTTTTGTTGTTGTTGTTTTTGG - Intronic
1078244051 11:9557115-9557137 GCTGCAGTTGTTGCAGTTTTTGG - Intergenic
1079152869 11:17916884-17916906 AATGCTGATGCTACTGATTTAGG - Intronic
1080069105 11:28057564-28057586 ATTGCTGTTGTTACTATTTTTGG + Intronic
1080629989 11:34065526-34065548 GATGCTGATGTTGCTGGTTTGGG + Intronic
1081007894 11:37771188-37771210 ACTGCTGCTGCTGCTGATGTTGG - Intergenic
1082065733 11:47898689-47898711 TTTGCTGTTGTTGCTTCTTTTGG - Intergenic
1082914656 11:58419311-58419333 GCTTTTGTTGTTGCTGCTTTTGG - Intergenic
1086980084 11:93186946-93186968 GCTGCTGATGTTGCTGGTCTGGG + Intronic
1087032700 11:93721876-93721898 ACTGCTGGGGTTGGTGATTTGGG + Intronic
1087551949 11:99662748-99662770 GCTGCTGCTGTTGCTGCTCTGGG - Intronic
1087828925 11:102798053-102798075 ACTGCTGCTGCTGCTGTTCTGGG - Exonic
1088252709 11:107875025-107875047 GCTGCTGATGTTTCTGATTCAGG - Intronic
1089321942 11:117632318-117632340 GCTGCTCTTGCTGCTGGTTTTGG + Intronic
1089363758 11:117908679-117908701 ATTGCTGTTGATGATGATCTCGG + Exonic
1090166182 11:124550778-124550800 TCTTCTGTTGATGCTTATTTGGG - Intergenic
1090331156 11:125933201-125933223 GCTGCTGCTGCTGCTGATCTGGG - Intergenic
1091966491 12:4746593-4746615 ACTCCTGTTTTTGCTGTCTTTGG - Intronic
1092087274 12:5773426-5773448 CTTGCTGTTGGTGGTGATTTTGG - Intronic
1093327237 12:17792322-17792344 TTTGCTGTTGTTGCTGCATTTGG - Intergenic
1093547625 12:20367946-20367968 ACTGCTGTTGTACCTGACTTGGG + Intergenic
1093910247 12:24739281-24739303 ATTTTTGTTGTTGTTGATTTTGG - Intergenic
1097336816 12:58393017-58393039 AATGTTGCTGTTGCTGGTTTGGG + Intergenic
1097809417 12:64002246-64002268 ACTGCTGCTGTTGCCATTTTGGG - Intronic
1098701401 12:73632403-73632425 AATGCTGTTGTTGCTGGTCCAGG - Intergenic
1098858492 12:75681321-75681343 ACTTCTGTTGTCGTTGCTTTTGG - Intergenic
1099139762 12:78957704-78957726 ACTGTTGTTGTTGTTATTTTGGG + Intronic
1099891546 12:88594571-88594593 AATGCTATTGTTGCTTGTTTTGG + Intergenic
1103864156 12:124038124-124038146 ACAGCTGTCTTTGCTGTTTTCGG - Intronic
1105427645 13:20308090-20308112 ACTGCTGTTTTTCTTGATTATGG - Intergenic
1107899134 13:44994762-44994784 TTTGTTGTTGTTGTTGATTTAGG + Intronic
1109838944 13:67897797-67897819 ACTCCTTTTGTTACTAATTTTGG - Intergenic
1110632007 13:77719722-77719744 GCTGCTTTTGTTGCTGGTTTTGG + Intronic
1111877997 13:93920531-93920553 ACTGCTCTTCTTTCTGAATTTGG + Intronic
1112666954 13:101585899-101585921 TCTGATGTTGATCCTGATTTTGG + Intronic
1113078149 13:106488713-106488735 ATTGTTGTTGTTGCTGATGAAGG + Intergenic
1113118297 13:106897914-106897936 ACTTCTGTTGATGGTCATTTGGG + Intergenic
1114774750 14:25468862-25468884 AATGCTGTTATTGCTGGTCTGGG - Intergenic
1115709086 14:36030213-36030235 GATGCTTTTGTTGGTGATTTTGG + Intergenic
1116051366 14:39807461-39807483 ATTGCTGATGCTGCTGATTTGGG + Intergenic
1117547085 14:56802301-56802323 TCTGCTGTTGTTGCTGTTGTTGG + Exonic
1117795568 14:59389571-59389593 GTTGTTGTTGTTGTTGATTTTGG + Intergenic
1118075164 14:62290255-62290277 GATGCTGTTGTTGCTGGTTTGGG + Intergenic
1118595473 14:67431684-67431706 GCTGCTGCTGTTGTTGAGTTGGG - Intergenic
1119970531 14:78965231-78965253 GATGCTCTTGTGGCTGATTTAGG - Intronic
1120110272 14:80546144-80546166 ACTGCTGTTGTGGCTGGTAAAGG + Intronic
1120639706 14:86996016-86996038 ACTGCTGTTGTTATTGCTATGGG - Intergenic
1120945517 14:89992001-89992023 ACTGCTGCTATTGCTTCTTTAGG + Intronic
1121520843 14:94585297-94585319 ACTGCTGTGGCTGCTGGGTTTGG + Intronic
1121586311 14:95065353-95065375 ACTGCAGTTGATGCTGGCTTGGG - Intergenic
1122480742 14:102045830-102045852 GCTGCTGCTGCTGCTGGTTTGGG - Intronic
1123148939 14:106163036-106163058 ACTGCTGTTCATGTTGATGTAGG - Intergenic
1123167793 14:106343082-106343104 AATGCAGTTGATGCTGATGTTGG + Intergenic
1123509949 15:20988205-20988227 ACTGCAGTCTTTCCTGATTTAGG + Intergenic
1123567166 15:21561951-21561973 ACTGCAGTCTTTCCTGATTTAGG + Intergenic
1123603429 15:21999244-21999266 ACTGCAGTCTTTCCTGATTTAGG + Intergenic
1124408981 15:29420067-29420089 GCTGCTGCTGTTGCTGCTTTAGG - Intronic
1126758662 15:51949323-51949345 ACTGCTGTTGTTCCTACTTTGGG - Intronic
1128528556 15:68429078-68429100 ACTGCTGCTGCTGATGATGTTGG + Intronic
1130259193 15:82342374-82342396 ACAACTGTTCTTGCTGGTTTGGG - Intronic
1130269484 15:82436813-82436835 ACAACTGTTCTTGCTGGTTTGGG + Intronic
1130282077 15:82526775-82526797 ACAACTGTTCTTGCTGGTTTGGG + Intergenic
1130473443 15:84242970-84242992 ACAACTGTTCTTGCTGGTTTGGG + Exonic
1130480857 15:84357034-84357056 ACAACTGTTCTTGCTGGTTTGGG + Intergenic
1130490855 15:84430725-84430747 ACAACTGTTCTTGCTGGTTTGGG - Intergenic
1130502439 15:84509493-84509515 ACAACTGTTCTTGCTGGTTTGGG - Intergenic
1130595722 15:85247576-85247598 ACAACTGTTCTTGCTGGTTTGGG + Intergenic
1130911883 15:88276449-88276471 GCTGCTGCTGTTGCTGCTGTGGG + Intergenic
1131640476 15:94287330-94287352 TATGCTGTTGTTGCTTATTCTGG + Intronic
1202975529 15_KI270727v1_random:289045-289067 ACTGCAGTCTTTCCTGATTTAGG + Intergenic
1133719492 16:8481578-8481600 AATTCTGTTGTTGCAGAATTAGG - Intergenic
1135028920 16:19021672-19021694 ATTCCTGGTGTTGCTGAATTTGG + Exonic
1135233075 16:20727851-20727873 GATGCTGATGTTGCTGGTTTGGG - Intronic
1135398376 16:22148259-22148281 AGAGCTGGTTTTGCTGATTTGGG + Exonic
1137264042 16:46854138-46854160 ACTGGTGTTGTTGCTCACTGAGG + Intergenic
1137775276 16:51048887-51048909 ACTCCTGTTGTCTCTGATCTCGG - Intergenic
1138436179 16:57001220-57001242 GCTGCTGTTGTTGGTTCTTTAGG - Intronic
1138464378 16:57177195-57177217 ATTGTTGTTGTTGTTGTTTTTGG - Intronic
1138549017 16:57737046-57737068 GCTGCTGCTGTTGCTGCTGTGGG + Exonic
1139993906 16:70962272-70962294 ACTGCAGTTCTTGTTTATTTGGG - Intronic
1140725744 16:77810253-77810275 AATGCTGATGCTGCTGATCTGGG - Intronic
1140739506 16:77928690-77928712 ATTGTTTTTGTTACTGATTTTGG - Intronic
1142321834 16:89388175-89388197 TCTGGTGTTAGTGCTGATTTTGG - Intronic
1144283072 17:13746033-13746055 ACTGGTTTTGGAGCTGATTTTGG - Intergenic
1144918700 17:18745746-18745768 AGTGCTGATGTTGCTGGTCTGGG + Intronic
1146072151 17:29692793-29692815 ACTGCTGATGCTGCTGATCCAGG - Intronic
1146678159 17:34787711-34787733 ACTGCTATTGTTGGGCATTTGGG - Intergenic
1147301860 17:39535763-39535785 AATGCTCTTGGTGCTGATCTTGG + Intronic
1147721400 17:42541819-42541841 GCTGCTGCTGCTGCTGGTTTTGG - Intronic
1147879378 17:43644045-43644067 AATGCTGATGCTGCTGATCTGGG - Intronic
1148684815 17:49495459-49495481 CCTGCTGCTGTTGCTGCTTCTGG + Exonic
1149024688 17:52013191-52013213 CCTCCTGTTGTTTCTAATTTTGG - Intronic
1149613750 17:57979266-57979288 GCTGCTGCTGCTGCTGCTTTTGG + Exonic
1150195717 17:63296406-63296428 CTTGCTGTTATTGCTTATTTTGG - Intronic
1150715164 17:67566675-67566697 ACTCCTGCTTTTCCTGATTTGGG + Intronic
1151250507 17:72830341-72830363 AATTCTGGTGTTCCTGATTTAGG - Intronic
1155578402 18:27275423-27275445 ACTGCTCTTGTTGCACTTTTCGG - Intergenic
1155987413 18:32245001-32245023 ACTGCGGCTGCAGCTGATTTGGG - Intronic
1156960205 18:43019222-43019244 ACTTTTGTTGTTGCTTATTCTGG - Intronic
1157873812 18:51253553-51253575 ACTGATGATGTTGCAGATGTTGG + Intergenic
1158225249 18:55194524-55194546 GATGCTGATGTTGCTGATTCAGG - Intergenic
1158705155 18:59785832-59785854 ACTGCTGTTGTTGTTTCATTTGG - Intergenic
1158718667 18:59903150-59903172 ATTGTTGTTGTTGCTGTTTTTGG + Exonic
1159131516 18:64285463-64285485 ACTGTTATTGTTGCTGATTCAGG - Intergenic
1159438787 18:68450905-68450927 ACTGGTGATGTTCCTGATTGTGG - Intergenic
1159783008 18:72681064-72681086 GCTGCTGATGTTGCTGGTCTGGG - Intergenic
1159943007 18:74422961-74422983 ACAGCCGTTGTTCGTGATTTAGG + Intergenic
1159951225 18:74485802-74485824 GCTGCTGCTGCTGCTGTTTTGGG + Intergenic
1160301369 18:77683125-77683147 ACTGCTGTTTTTGAACATTTGGG + Intergenic
1163532592 19:17859381-17859403 AATGCTGTTTTTGTTAATTTGGG - Intergenic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
1165805015 19:38575177-38575199 ACTGGAGTTGGTGCTGAGTTAGG + Intronic
1166700294 19:44878284-44878306 ACTGCTGGTGCTGCTGCTTCTGG + Intronic
1167366386 19:49056986-49057008 ACTGTGGTTGTTGCTGCTATAGG + Intronic
925035023 2:678377-678399 ACGACTGTTGTTGCTGAGTTTGG + Intergenic
926389117 2:12369064-12369086 TCTGCTTTTGTTGCTTTTTTAGG + Intergenic
927611186 2:24542636-24542658 ACTACTGTTGTAGGTGATGTTGG + Intronic
928821629 2:35368335-35368357 TCTGTTGTTGTTGTTGTTTTTGG + Intergenic
929337281 2:40764294-40764316 ATGGCTGAAGTTGCTGATTTTGG + Intergenic
932000172 2:67877738-67877760 GCTGCTGTTGCTGCTGCCTTTGG - Intergenic
932135676 2:69226533-69226555 ACTGCTTTTGTTGCTGCTCCTGG - Intronic
932167174 2:69519025-69519047 GCTGCTGCTGTTGCTGCTTGAGG + Exonic
932623043 2:73277470-73277492 GCTGCAGAGGTTGCTGATTTGGG - Intronic
933475264 2:82781190-82781212 ACTACTGTTGGTGCTGATGTTGG + Intergenic
933555177 2:83823070-83823092 ACTGTTGCTGTAGCTGCTTTTGG - Intergenic
933565836 2:83949544-83949566 AATGCTGATGCTGCTGATTTGGG - Intergenic
933650767 2:84848260-84848282 ACAGCAGTGGTTGCTGATTGGGG - Intronic
935397619 2:102624494-102624516 ACTGGGGTTTTTGCTAATTTGGG + Intronic
935457369 2:103285174-103285196 ACTGTTGCTGTTATTGATTTGGG - Intergenic
935812856 2:106817114-106817136 ACTGCCGTTGATGTTTATTTAGG - Intronic
936582838 2:113719502-113719524 ACTATTGTTGTTGGTAATTTAGG - Intronic
936919911 2:117677223-117677245 ACTGCTGTTTGTGCTTGTTTTGG - Intergenic
936924822 2:117725782-117725804 ACTGTTGGTGTTGCTGGTCTGGG - Intergenic
937776951 2:125789107-125789129 GTTGCTGTTGTTGCTGAGATAGG - Intergenic
939906031 2:147916359-147916381 GCTACTGTTGTTGCTGTTGTCGG - Intronic
940468589 2:154064276-154064298 ACTGCTTTTCATGCTTATTTAGG - Intronic
940586019 2:155651483-155651505 GCTGCTGTTGTTGCTGTTGTTGG + Intergenic
941940598 2:171033294-171033316 ACTGTTGTTGTTTATGCTTTTGG - Intronic
942577056 2:177374804-177374826 AATGCTGATGTTGCTGGTCTGGG + Intronic
942906219 2:181183980-181184002 GCTTCTGTTGTTTCTTATTTGGG - Intergenic
943034909 2:182731053-182731075 ACTGCTTTTGCTGCTGGTATTGG + Exonic
943436960 2:187876783-187876805 ACTGCAGTTTTTGCTTATTTCGG - Intergenic
943677109 2:190726565-190726587 ATTGTTGTTGTTGCTGTTGTTGG + Intergenic
944634199 2:201658924-201658946 CCTGCTGTTGTTGCTCACTCTGG + Intronic
946665384 2:222044442-222044464 GCTGTTGCTGTTGTTGATTTTGG + Intergenic
947058195 2:226131845-226131867 ATTGCTGGTGTTGCTGAATGGGG - Intergenic
947690581 2:232132554-232132576 CCTTCTGTTGTTGCTGTTGTTGG - Intronic
948782371 2:240329677-240329699 GCTGCTGCTGTTGCTGTTTCAGG + Intergenic
1169824357 20:9750683-9750705 ACTGCTGCTGTAGCTTCTTTTGG - Intronic
1169986369 20:11449833-11449855 AGTTCTGTTGTTACTCATTTAGG - Intergenic
1170474122 20:16698039-16698061 GCTGTTGTTGTTGTTGTTTTTGG + Intergenic
1171047225 20:21821554-21821576 AATGCTGATGCTGCTGGTTTTGG - Intergenic
1171047383 20:21823074-21823096 AATGCTGATGCTGCTGATTTAGG + Intergenic
1171503093 20:25609907-25609929 ACTGCAGTTTTAGCTGAGTTTGG - Intergenic
1173192121 20:40884666-40884688 ACTGCTGTTGCTGACCATTTGGG - Intergenic
1173998696 20:47358784-47358806 GTTGCTGTTGTTACTGTTTTAGG + Intergenic
1175750258 20:61491737-61491759 AGTGTTGATGTTGCTGATGTTGG + Intronic
1177237572 21:18412732-18412754 GCTGCTGCTGCTGCTGAGTTGGG + Intronic
1178792013 21:35709311-35709333 ACTTTTGTTGTTGCTGTTGTTGG - Intronic
1180320243 22:11313287-11313309 ACAGCTGTTGTGACTGATTGTGG + Intergenic
1180962703 22:19769353-19769375 ACTGCTGCTGTTGCTGCTGAGGG + Intronic
1181104612 22:20566514-20566536 GCTGCTGCTGTTGCTGTTGTTGG - Exonic
1181362552 22:22349300-22349322 AGTGCTGAAGTAGCTGATTTGGG + Intergenic
1181829061 22:25544761-25544783 GCTGCTGTTGTTACTGTTTAAGG + Intergenic
1182483580 22:30625989-30626011 GCTGCTCTTGTTGGTGATGTGGG - Intronic
1183388886 22:37532250-37532272 TCCGTTGTTGTTGCTGTTTTTGG + Intergenic
1183811620 22:40262393-40262415 ACTGCTGTTGCTTATTATTTTGG + Intronic
949839639 3:8305945-8305967 CATTCTGTTGTTGTTGATTTTGG + Intergenic
951069096 3:18305155-18305177 GCTGTTGTTGTTGTTGTTTTTGG + Intronic
951133730 3:19078506-19078528 GATGCTGTTGCTGCTGATCTGGG + Intergenic
951342370 3:21504259-21504281 ATTGTTGTTGTTGTTGTTTTTGG - Intronic
952056741 3:29455991-29456013 ACTGCTGTGAGTACTGATTTGGG + Intronic
955441011 3:58955609-58955631 ACTGCTGTTGAAGTTTATTTGGG - Intronic
955741906 3:62100159-62100181 ACAGCAGTTGTGGCTGAGTTCGG - Intronic
957004596 3:74930005-74930027 ACTGTTGTTGTTATTGGTTTAGG - Intergenic
957447683 3:80336630-80336652 ACTCCTGTTGTTTATGATTGTGG + Intergenic
958096265 3:88949286-88949308 ACAGGTGTTGTTACTGCTTTGGG - Intergenic
958634760 3:96729658-96729680 AGTGCTGTTGCTGTAGATTTGGG - Intergenic
958735189 3:98001074-98001096 ACTGTGGTTGATTCTGATTTTGG + Intronic
958809543 3:98844732-98844754 ACTGCTGGTGTTACTGAGTGAGG - Intronic
958962979 3:100528117-100528139 ACTTCTGTTGTTGCTAAGTATGG + Intronic
959405298 3:105954858-105954880 ACTGCTTTTATTTCTGATATTGG + Intergenic
959904653 3:111697954-111697976 ACTCCTTTTGATGTTGATTTTGG + Intronic
960166923 3:114412798-114412820 ACTGAAGTTTTTGCTCATTTTGG - Intronic
960982883 3:123248334-123248356 TTTGCTATTGTTGTTGATTTTGG - Intronic
962343402 3:134603253-134603275 GCTGCTGTTGTTGTTGCTGTAGG - Intronic
965403431 3:168241208-168241230 AATGCTGATGCTGCTGGTTTGGG + Intergenic
965448567 3:168807489-168807511 ACTGCTGTTATTGCAGAGATAGG - Intergenic
965733525 3:171797395-171797417 AATGCTGATGCTGCTGGTTTGGG - Intronic
965808185 3:172564585-172564607 TTTGCTGGTGTTGCTGACTTTGG - Intergenic
966035677 3:175411724-175411746 AATACTTTTGTTTCTGATTTTGG - Intronic
969087609 4:4668048-4668070 CATGCTGATGTTGCTGGTTTGGG + Intergenic
969127732 4:4965592-4965614 ACTGAGGTTGTTGCTGATGGGGG + Intergenic
970047560 4:11873095-11873117 AATGATGTTGTTACTGAATTTGG - Intergenic
972226821 4:37023113-37023135 ACTGCAGGTGTTGCAGTTTTTGG - Intergenic
972260733 4:37406129-37406151 GTTGCTGCTGTTGCTTATTTTGG - Intronic
972407490 4:38760934-38760956 TCTGCTGTTGTTTCTAATTAGGG + Intergenic
972503240 4:39697352-39697374 GCTGCTGTTGGTGCTGGTTCCGG - Intergenic
973205781 4:47558675-47558697 ACTGTTGTTATTGATGATTTGGG + Intronic
973575866 4:52288728-52288750 AATGCTGATGTTGCTGGTCTGGG + Intergenic
973754100 4:54055485-54055507 GCTGCCGTTGAAGCTGATTTGGG + Intronic
974761465 4:66280625-66280647 TCTGCTATTGTTGCTGATGTAGG + Intergenic
974763015 4:66303231-66303253 CCTTCTGTTGTTCCTAATTTTGG + Intergenic
976735852 4:88308471-88308493 ATTGTTGTTGTTGTTGTTTTGGG + Intergenic
978395228 4:108271888-108271910 ACTGCTGTTGTTGTTTTGTTAGG - Intergenic
979200437 4:117971438-117971460 ACTGCTGCTGCTGCTGTTTAAGG - Intergenic
979495413 4:121377711-121377733 AATCCTGTTTTTGCTCATTTTGG + Intronic
980007281 4:127557630-127557652 ACTGCTGCTGTTGCTGAACTAGG - Intergenic
983091499 4:163508359-163508381 GGTGCTGTTGCTGCTGGTTTAGG + Intronic
983619973 4:169750970-169750992 ATTCCTGTTGTTTCTTATTTTGG + Intronic
984920955 4:184763821-184763843 ATGTCTGTTGTTGCTGCTTTTGG - Intronic
985534708 5:457530-457552 GCTGCTGTGGTTGCTGAGTCTGG + Intronic
987177267 5:15327048-15327070 ACTGCTGTGGTTTCTCAATTAGG - Intergenic
987575233 5:19718980-19719002 ACTGCTGTAGTTTGTGATTTGGG - Intronic
988211403 5:28209463-28209485 ACTACTGTTGTTACTGATGCAGG - Intergenic
991186998 5:63820708-63820730 ACTGCTGTAATTGCTGATGAAGG - Intergenic
992614930 5:78538630-78538652 GGTGTTGTTGTTGTTGATTTTGG - Intronic
992699116 5:79322679-79322701 ACAGCTTTAGGTGCTGATTTTGG + Exonic
993449035 5:88051956-88051978 TTTGTTGTTGTTGTTGATTTTGG + Intergenic
995287559 5:110408706-110408728 ACTCCTGATGTTACTTATTTGGG - Intronic
996536497 5:124583323-124583345 AATGCTGATGTTGCTGGTATGGG - Intergenic
997441321 5:133910722-133910744 ACTGCCATTGCTTCTGATTTGGG + Intergenic
997722363 5:136089242-136089264 ATTGCTGTTGTTGTTAATGTAGG - Intergenic
997778916 5:136637701-136637723 CCTGGTGTTGTTGTTGGTTTTGG - Intergenic
998168599 5:139858955-139858977 GCTGCTCTCGTGGCTGATTTGGG - Intronic
998205836 5:140156208-140156230 ACTGCTGCTGCTGCTGCTGTTGG - Intergenic
999091393 5:148939347-148939369 GATGCTGTTGCTGCTGATTTGGG - Intronic
999204804 5:149840361-149840383 TGTGCTGTTGGTGGTGATTTAGG + Intronic
999435912 5:151563241-151563263 AATGCTGATGGTGCCGATTTGGG + Intronic
999665779 5:153911329-153911351 ACTGCTCTTGTTTCTGACCTTGG - Intergenic
1000445049 5:161308974-161308996 TCTGTTGTTGTTACTGCTTTTGG - Intronic
1000750724 5:165093429-165093451 TCTGCTCTTGTTCCTGGTTTGGG - Intergenic
1000828495 5:166075060-166075082 CAGGCTGTTGTTGCTCATTTTGG + Intergenic
1000941462 5:167367013-167367035 CCTTTTGTTGTGGCTGATTTTGG + Intronic
1001246425 5:170108451-170108473 ACCGCTGTGGTTGCTGAGGTTGG - Exonic
1001418512 5:171567154-171567176 ACTTCTCTTGTTTCTGATATTGG + Intergenic
1001701669 5:173711272-173711294 CTTGCTGTTGTTGCTGTGTTGGG + Intergenic
1002103137 5:176867219-176867241 ACTGCTGGGGATGCTGGTTTTGG + Intronic
1004801089 6:19148975-19148997 GCTGCTGTTGTTGCTATTGTTGG - Intergenic
1004861672 6:19809920-19809942 ACTGCTATTGATGGTAATTTAGG + Intergenic
1006660110 6:35634313-35634335 GTTGTTGTTGTTGTTGATTTAGG - Intronic
1007155968 6:39744071-39744093 GCTGCTGTTCTCGCTGATTTGGG - Intergenic
1009785525 6:68333403-68333425 GCTGTTGTTGTTGTTGTTTTTGG + Intergenic
1010607142 6:77905178-77905200 TTTGCTGTTGTTGTTGTTTTGGG + Intronic
1011725459 6:90206036-90206058 ACTGCTGTTGTTTTTAATGTTGG - Intronic
1011900323 6:92286624-92286646 GTTGGTGTTGTTGCTGTTTTTGG + Intergenic
1012427823 6:99133590-99133612 TGTGTTGTTGTTGCTTATTTTGG - Intergenic
1013537849 6:111079538-111079560 AATGCTGTTGTCACTGCTTTTGG - Intergenic
1015395331 6:132727428-132727450 TTTGTTGTTGTTGTTGATTTTGG - Intronic
1015565691 6:134568101-134568123 TTTGCTATTGTTGCTGATGTTGG + Intergenic
1015784581 6:136908875-136908897 ACAGCATTTGTTGCTGTTTTTGG - Intronic
1016581729 6:145635651-145635673 AGTACTGGTGTTGCTGCTTTGGG + Intronic
1016637409 6:146309744-146309766 ACAGTTGTTGTTACTGTTTTGGG + Intronic
1018076411 6:160218759-160218781 GCTGCTGTTGTTGCTATTGTTGG - Intronic
1018377839 6:163230762-163230784 ACTGCTGTAGGTGCAGAGTTAGG + Intronic
1018985341 6:168632203-168632225 ACTTCTGATGTTCCTGAGTTAGG - Intronic
1019327871 7:447007-447029 ATTGTTTTTGTTGCTGTTTTGGG + Intergenic
1019617534 7:1972529-1972551 ATTGCTGATATTGATGATTTTGG + Intronic
1019653560 7:2173972-2173994 GCTGCTATTGTTGCTGTTGTTGG + Intronic
1020086439 7:5313199-5313221 ACTGCTGCTGCTGCTGCTCTCGG + Exonic
1020345433 7:7157335-7157357 ACTGCTGTTGTCTGTGGTTTGGG + Intronic
1020378843 7:7519503-7519525 ACTGCTGTTGTTCTTGAACTTGG + Intronic
1020423257 7:8034877-8034899 ACTGGTGTGGGTGGTGATTTGGG + Intronic
1020442758 7:8235937-8235959 TCTTCTATTGTTGATGATTTGGG + Exonic
1021427402 7:20517537-20517559 ACTTTTCTTGTTGCTAATTTGGG - Intergenic
1021570152 7:22056925-22056947 GCTGCTGCTGCTGCTGATCTGGG + Intergenic
1022578890 7:31527727-31527749 GCTGCTGTTGTTTTTGTTTTGGG - Intronic
1026615361 7:71897798-71897820 TCTGCTGTTTTTGCTGGTTTGGG - Intronic
1026952181 7:74354953-74354975 ACTGCTGGCGTTGCTGGGTTAGG + Intronic
1027520861 7:79204843-79204865 AATTCTGTTATTGATGATTTCGG - Intronic
1027887039 7:83921750-83921772 ACATCTGTTGCTGCTGAATTTGG - Intergenic
1028896592 7:96048430-96048452 AATGCTGTTGCTTCTGATCTGGG - Intronic
1031120005 7:117711627-117711649 ACTGCTGCTGCTGCTTCTTTTGG + Exonic
1033431186 7:141291131-141291153 AGTGCTGCTGTTGCTGGATTCGG + Intronic
1033440396 7:141373315-141373337 GCTGTTGTTGTTGTTTATTTGGG - Intronic
1033520982 7:142160113-142160135 TTTGTTGTTGTTGCTGATTAGGG + Intronic
1033645344 7:143298152-143298174 GATGCTGCTGTTGCTGCTTTAGG + Intronic
1034637235 7:152577019-152577041 TCTGCTGTTGGTGGTGGTTTGGG - Intergenic
1035342521 7:158173046-158173068 GATGCTGTTGTTGATGATTGGGG - Intronic
1035697983 8:1614649-1614671 GCTGCTGTAGTTGTTGGTTTGGG - Intronic
1035774729 8:2179355-2179377 CATGCTGCTGCTGCTGATTTTGG + Intergenic
1035967165 8:4205654-4205676 ACGGCTGTTGTGGCTCATTTGGG + Intronic
1037303819 8:17483575-17483597 ATTGCAGTTGTTGCTGAGGTTGG + Intergenic
1039213451 8:35241109-35241131 GCTGCTGTTTCTGCTGTTTTGGG + Intronic
1040673906 8:49725774-49725796 ACTGGAGATGTGGCTGATTTGGG + Intergenic
1041817109 8:61986219-61986241 GCTGCTGATGGTGCTGCTTTGGG - Intergenic
1042662998 8:71176509-71176531 GATGCTTTTGTTGTTGATTTAGG + Intergenic
1044147244 8:88732334-88732356 GTTGTTGTTGTTGCTGTTTTGGG - Intergenic
1044944279 8:97376149-97376171 GCTTCTGTTGTTGCTGTTCTTGG - Intergenic
1045682505 8:104677867-104677889 GCTGCTGTTATTGCTGTTTTAGG - Intronic
1045953718 8:107882454-107882476 GCTGCTGATGATGATGATTTGGG - Intergenic
1047323531 8:123813390-123813412 ACTTCTGTTGTCACTGACTTTGG + Exonic
1047960429 8:130007784-130007806 TTTGTTGTTGTTGCTGTTTTTGG - Intronic
1048475505 8:134738982-134739004 CCTGAAGGTGTTGCTGATTTGGG - Intergenic
1048490588 8:134888931-134888953 ACTTGTGTTGTTTGTGATTTTGG + Intergenic
1049397167 8:142406311-142406333 ACTTCCATTGTAGCTGATTTGGG + Intergenic
1050646064 9:7720838-7720860 GCTGCTGATGTTGCTGGTTTGGG + Intergenic
1050869593 9:10550475-10550497 ACTGAGCTGGTTGCTGATTTAGG + Intronic
1051337664 9:16080885-16080907 GCTTCTGTTTTTGCTGATGTGGG + Intergenic
1053033707 9:34806430-34806452 GCTGTTGTTGTTGTTGTTTTGGG + Intergenic
1054745225 9:68847386-68847408 ACTGCTGTTGTTGCTGATTTAGG - Intronic
1055219633 9:73913095-73913117 AATGCTGATGTTGCTGGTCTGGG - Intergenic
1055540179 9:77295716-77295738 AATGTTTTTGTTGCTGATTTTGG + Exonic
1057372844 9:94489743-94489765 GTTGTTGTTGTTGTTGATTTGGG + Intergenic
1058595998 9:106616361-106616383 ACTGCTATTGTTTCTATTTTAGG - Intergenic
1058624444 9:106919944-106919966 ACTTTTGATTTTGCTGATTTTGG + Intronic
1059559847 9:115323766-115323788 ATTGCTATTATTGGTGATTTCGG - Intronic
1059665372 9:116441392-116441414 ACTGTTGTTGGTAATGATTTAGG - Intronic
1059753812 9:117273767-117273789 ACTGCTGCTTGTGCAGATTTTGG - Intronic
1061569446 9:131467732-131467754 CCTGCTGTTGTTGCTGCTGCTGG - Exonic
1061987849 9:134140456-134140478 GGTGCTGTTGGTGCTGAGTTTGG + Intronic
1203368463 Un_KI270442v1:279041-279063 ACAGCTGTTGTGACTGATTGTGG + Intergenic
1185678079 X:1865132-1865154 ACTGCTGATGTGGCTGGTATAGG - Intergenic
1186172315 X:6890399-6890421 ACTGCTGTAGATATTGATTTGGG - Intergenic
1186175646 X:6923450-6923472 ACTGCAGGAGTTGCTGGTTTGGG - Intergenic
1186285272 X:8036995-8037017 AATGCTGTTGCTTCTGACTTTGG + Intergenic
1186480584 X:9893968-9893990 GTTGTTGTTGTTGTTGATTTTGG - Intronic
1186783230 X:12934308-12934330 GCTGCTGATGCTGCTGATTGGGG + Intergenic
1186914912 X:14208532-14208554 AATGCTGTTGGTGGTGATTTGGG - Intergenic
1187294652 X:17986963-17986985 ACTGCTCTTCTTGCTAACTTGGG + Intergenic
1187838883 X:23465017-23465039 ACCCCTGTTGTTGGAGATTTAGG - Intergenic
1188191626 X:27178343-27178365 TTTGTTGTTGTTGTTGATTTGGG - Intergenic
1189456524 X:41195474-41195496 AATGCTGATGTTGCTGCTCTGGG + Intronic
1189537645 X:41952969-41952991 CCTGCTGTTGTTTGTGATTCTGG - Intergenic
1190360852 X:49646812-49646834 CCTGTTTTTGTTGCTGATGTTGG - Intergenic
1190499380 X:51059890-51059912 ACTAATGTTGGTGGTGATTTGGG + Intergenic
1190522993 X:51299027-51299049 GGTGCTGCTGCTGCTGATTTAGG - Intergenic
1190744969 X:53317112-53317134 TCTGCTTTTGTTGTTGATCTTGG - Intronic
1190804905 X:53825878-53825900 ACTGCTATGGTTGCTGTTTGCGG + Intergenic
1190934750 X:54987916-54987938 CCTTCTGTTGTTACTGATCTTGG - Intronic
1191133671 X:57041412-57041434 ACTGGTGTGGGTGGTGATTTGGG - Intergenic
1191639951 X:63419910-63419932 TCTCCTGTTGTTTATGATTTTGG + Intergenic
1191909241 X:66130152-66130174 GTTGTTGTTGTTGCTGTTTTTGG - Intergenic
1192247253 X:69384057-69384079 CCTGCTGTTGTAGATGATGTTGG + Intergenic
1193479251 X:82007180-82007202 TTTGCTGTTGTTGCTGTTTTTGG + Intergenic
1193652316 X:84152274-84152296 ACTACTTTTGTAGTTGATTTTGG - Intronic
1195917357 X:109948695-109948717 ACTGCAGTTGTAGCTGCATTAGG - Intergenic
1196182336 X:112705465-112705487 GCTGCTGTTGGTGCTGGTTGTGG - Intergenic
1196828638 X:119759428-119759450 ACTGCTGTTGTTGTTCAGGTTGG - Exonic
1198739927 X:139831400-139831422 AGTGTTGTGCTTGCTGATTTAGG - Intronic
1201892519 Y:18958215-18958237 ACTGCTTGTCTTGCTAATTTGGG - Intergenic
1201977960 Y:19872586-19872608 GCAGCTGTTTGTGCTGATTTAGG - Intergenic
1202014651 Y:20388059-20388081 TTTGTTGTTGTTGCTGTTTTGGG - Intergenic