ID: 1054746676

View in Genome Browser
Species Human (GRCh38)
Location 9:68860835-68860857
Sequence GCTGGGACTCACCTCTAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054746676 Original CRISPR GCTGGGACTCACCTCTAGGG AGG (reversed) Intronic
902189702 1:14753754-14753776 CCCTGCACTCACCTCTAGGGAGG + Intronic
905208270 1:36355494-36355516 CCTGGGACTCTCCTCTGGAGTGG + Intronic
905476419 1:38231863-38231885 GCATGAACCCACCTCTAGGGAGG + Intergenic
905771251 1:40639325-40639347 GCTCGGACCCACCTCATGGGTGG - Intronic
906681417 1:47728206-47728228 GCAGGGAGTCTCCTCTAGTGAGG - Intergenic
907477198 1:54713665-54713687 GCTAGGACCCAGGTCTAGGGTGG + Intronic
910900536 1:92115461-92115483 GCTGGGGCTCACTTAGAGGGTGG - Intronic
911121604 1:94302341-94302363 GCTGGGGCTCACTTAGAGGGTGG + Intergenic
911605338 1:99898477-99898499 TCTGGGAATCACCTCTAGATCGG - Intronic
911960963 1:104301807-104301829 GCTGGGACTCAGTTCAGGGGAGG - Intergenic
913014139 1:114716038-114716060 ACTGGGCCTCACCTCTATGGTGG + Exonic
915608284 1:156969270-156969292 GCTGGGACTCACCTCACTGAGGG + Exonic
917661452 1:177181347-177181369 GCTGGGGCTCCCCGCGAGGGAGG - Intronic
923099073 1:230797994-230798016 GATGGGACTCTCATCAAGGGCGG - Intronic
1062801670 10:385672-385694 GCTGGGACTCACACCTACAGGGG + Intronic
1063604984 10:7515272-7515294 GCTGGAACTGAAATCTAGGGTGG - Intergenic
1065207733 10:23373161-23373183 GCTGGGACTCCCAGCTTGGGAGG - Intergenic
1067151953 10:43743183-43743205 GCTAGGACTATCCTCAAGGGAGG - Intergenic
1069625780 10:69866932-69866954 GCTGGGAATCACCGGGAGGGTGG + Intronic
1069710750 10:70486982-70487004 TCTGGGGCTCGTCTCTAGGGAGG - Intronic
1074389778 10:113047397-113047419 GCTGGGTCTCTGTTCTAGGGCGG - Intronic
1077145845 11:1043976-1043998 GCTGGAACTCACATCACGGGTGG - Intergenic
1078267759 11:9767574-9767596 GCTGAGACTCACCAGTTGGGGGG - Intergenic
1079331640 11:19538211-19538233 GCTGTGACACATCTCTAGAGTGG + Intronic
1080635439 11:34119362-34119384 GCTGGGACTCAGCCCTAAGCGGG - Intronic
1080667305 11:34346969-34346991 GCTTGGCCTCAACTGTAGGGAGG + Intronic
1081783387 11:45729098-45729120 GCTGCCACTCACCTCTAAGGTGG + Intergenic
1082243549 11:49893743-49893765 GCTGGGACCCAGCTGCAGGGTGG - Intergenic
1083764816 11:64836691-64836713 GGTGGGACTCAGCCCTGGGGGGG + Intronic
1092329130 12:7566684-7566706 GCTGGGGCTCACCTGGAGAGGGG + Intergenic
1097693443 12:62755545-62755567 GCTGGGACTCACTTGCAGCGGGG + Intronic
1101913851 12:108880985-108881007 GCTGGGACTGAGGTTTAGGGAGG - Intronic
1103780980 12:123398779-123398801 GCTGGGGCTCATCTGAAGGGTGG + Intronic
1103781666 12:123402794-123402816 GCTGAGATTCACCTGTATGGAGG - Intronic
1105278238 13:18948487-18948509 GCCGGGCCTCCCCTGTAGGGGGG - Intergenic
1111538294 13:89633330-89633352 GCTGGGAGTCACCTGTAGCTAGG + Intergenic
1112100996 13:96189441-96189463 GCTGGGACTTCCCTCTAGCATGG + Intronic
1115961146 14:38837167-38837189 CCTGGGACTCCCCTCCAGGGTGG - Intergenic
1122828828 14:104385638-104385660 GCTGGGGCTCATCTTTAGGTGGG - Intergenic
1123931049 15:25171811-25171833 CCACGGACTCACCTCCAGGGTGG + Intergenic
1124878518 15:33619781-33619803 CCTGGGTCTCAACTCTAGAGGGG - Intronic
1125214999 15:37262020-37262042 GCTGGGTCTCACAATTAGGGAGG + Intergenic
1128036278 15:64529326-64529348 GCTGGGGCTCACTTGCAGGGGGG - Intronic
1128807165 15:70539714-70539736 GCTGGGACTGACCCCTGGGCAGG + Intergenic
1129769569 15:78194452-78194474 GCTGGGAGGCACATCTGGGGAGG + Intronic
1130785349 15:87089859-87089881 GCTGAGACTCATCTGTGGGGAGG + Intergenic
1134133422 16:11665121-11665143 GCTGGGACTCCCTGCTCGGGTGG - Intergenic
1136288111 16:29255755-29255777 GCAGAGACGCACCCCTAGGGAGG + Intergenic
1136609430 16:31357165-31357187 GCTGGGAGTCTCCTGTAGGGTGG + Intronic
1137280122 16:46969541-46969563 GCTGGCACTCTCCACTAGTGGGG + Intronic
1138375227 16:56558745-56558767 GCTGAGACCCACCTCCTGGGAGG + Intergenic
1139383877 16:66551560-66551582 GCTGGCAGTCACCACTAGGCAGG + Intronic
1139513271 16:67439262-67439284 GCAGGCACTCACCTCCAGGATGG + Exonic
1140936073 16:79671464-79671486 GTTTGGACTCACCTCTGAGGAGG + Intergenic
1141179637 16:81743710-81743732 GATGGGCCTCACCTCCAGGCAGG - Intronic
1143388881 17:6548465-6548487 GCTGGGACTAGCCTCACGGGGGG + Intronic
1143697613 17:8631416-8631438 GCTGCGACTCACCTGCAGTGGGG + Intergenic
1144759280 17:17698306-17698328 GGTGGGACTCAACTCTTGAGTGG - Intronic
1145869229 17:28259824-28259846 TCTGGGACTCCCCTATAGTGTGG + Intergenic
1148261972 17:46192621-46192643 GCTGGGAGTCGCCCCAAGGGCGG - Exonic
1158113195 18:53964609-53964631 GTTGGCACTTTCCTCTAGGGTGG + Intergenic
1158892988 18:61890353-61890375 GATGGAACTCACCTCTGGGTAGG + Intronic
1160135772 18:76270368-76270390 TCTGAGACAGACCTCTAGGGTGG - Intergenic
1160941582 19:1622545-1622567 GCTGGGATTTACCTAAAGGGGGG - Intronic
1161300306 19:3539268-3539290 GGAGGGGCTCACCTGTAGGGAGG - Intronic
1164412091 19:28014559-28014581 TCTGAGCCTCACCTCTAGAGTGG - Intergenic
1166350793 19:42197105-42197127 GCTGAGGCTCTCCTCTAGGTGGG - Intergenic
1167416599 19:49376542-49376564 GATGGGACTCAGCACTGGGGAGG - Intergenic
928436612 2:31258549-31258571 GCTGGGACTCAAGTCCAGGAAGG - Intronic
929917810 2:46150917-46150939 ACTAGGACTCAACTGTAGGGAGG + Intronic
941887298 2:170541280-170541302 GCTGTGACACACCTATAGGATGG - Intronic
941955100 2:171195923-171195945 GCTGGGACTCACCTGGGAGGTGG + Intronic
1172031114 20:31982802-31982824 GCTGAGACCCACTTCTAGGCTGG - Intronic
1176109292 20:63404236-63404258 GCGGGGCCTCACCTCGGGGGAGG + Intergenic
1179173700 21:38992165-38992187 GCTGCGGCTCACCTCTGGGCCGG - Intergenic
1179603572 21:42496976-42496998 GCTGGGACTCATGTCGAGGTCGG - Intronic
1182350110 22:29694658-29694680 ACTTGGACTCACCTCAAAGGTGG - Intronic
1182621357 22:31620449-31620471 GTTGGGACTGAATTCTAGGGAGG - Intronic
1183406181 22:37631747-37631769 GCTGTGACTCGGCTCTGGGGTGG + Intronic
1184428690 22:44428406-44428428 GCTGGGACCCTCCTCTCAGGGGG + Intergenic
1184750564 22:46484086-46484108 TCTCAGACTCACCTGTAGGGAGG + Intronic
1185177055 22:49333894-49333916 GCCGGCACTCACCTCCAGGCGGG - Intergenic
1185323030 22:50210546-50210568 CCTGGGCCTCCCCTCCAGGGTGG + Intronic
950599371 3:14018436-14018458 GCTGGGACTCACCTCAGAAGTGG - Intronic
952496057 3:33916604-33916626 CCTGGGACTAACTTGTAGGGTGG + Intergenic
957380086 3:79416484-79416506 GAGGGCACACACCTCTAGGGAGG + Intronic
961382536 3:126505274-126505296 GCCTGCACTCACCTCTATGGAGG + Intronic
962619658 3:137164903-137164925 GCTGGGACCCACCCCTAGGTGGG - Intergenic
966730853 3:183150246-183150268 GCAGGGACTCAACACTTGGGTGG + Intronic
966918331 3:184596966-184596988 GCTGGGTTTCACCTCTAGCTGGG + Intronic
967932155 3:194697853-194697875 CCTGGGACTGTGCTCTAGGGTGG + Intergenic
968701994 4:2061691-2061713 GCTGGGTCTGGGCTCTAGGGGGG + Intronic
972382844 4:38535420-38535442 GCCTAGAATCACCTCTAGGGAGG + Intergenic
974699650 4:65424052-65424074 GGTGGGACTCACCATTAGAGTGG - Intronic
979121445 4:116907221-116907243 GCTGGAACTCTCCTCAAGGTTGG + Intergenic
980510132 4:133774225-133774247 GCTGAAACTCACCTAGAGGGAGG - Intergenic
980882469 4:138726329-138726351 GATGGTACTCACCACTAAGGAGG + Intergenic
983575624 4:169258216-169258238 GCTGAGAATCACCTATATGGTGG - Intronic
985733914 5:1566315-1566337 GCCGGGACCCACCTCAGGGGAGG + Intergenic
986659317 5:10044966-10044988 GTTGCCACTCACCTCTAGGCTGG + Intergenic
992023833 5:72651579-72651601 GCTGGGTCTCACGTCCATGGTGG - Intergenic
996373253 5:122775201-122775223 ACGCGGTCTCACCTCTAGGGTGG - Exonic
999726287 5:154440861-154440883 GCTGGGACTCCCATCTACTGAGG - Intergenic
1004483461 6:16042981-16043003 ACTGGCAGTGACCTCTAGGGAGG + Intergenic
1007309653 6:40935219-40935241 GCTGGGGCTCAGCCCTATGGGGG + Intergenic
1008602676 6:53111135-53111157 GATGGGATTCACATCTAGGTAGG + Intergenic
1011071732 6:83392737-83392759 GCTGGGGCTCACTTGGAGGGAGG + Intronic
1014221948 6:118806680-118806702 GCTGGGAATGGCCTGTAGGGAGG + Intergenic
1017440991 6:154464206-154464228 GCTGGGACTGACTGTTAGGGTGG + Intronic
1019264481 7:105893-105915 TCTGGGACGCACACCTAGGGGGG - Intergenic
1022907817 7:34873484-34873506 GCTGGCACCCACCTCTGGGGAGG + Intronic
1031910543 7:127512675-127512697 GGTGGGACTCAACTCTAGGCAGG + Intergenic
1034911946 7:155003840-155003862 TCTGGGACTCTCCTCCAGCGCGG - Intergenic
1035315019 7:157992215-157992237 CATGGAACTCACCTTTAGGGTGG - Intronic
1036808659 8:11852598-11852620 GCAGGCACTCACCTCTGGGGTGG + Exonic
1039489550 8:37937230-37937252 GCTGTAAGTCAGCTCTAGGGAGG + Intronic
1040735361 8:50500918-50500940 GCTGGTACTCTCCACTAGGATGG + Intronic
1043506453 8:80907801-80907823 ACTGGGACTCACAACTTGGGGGG + Intergenic
1044624512 8:94223710-94223732 GCTGGGATTCACGTCCAGGTGGG + Intergenic
1051877316 9:21806206-21806228 GCTGGGGCTGAAGTCTAGGGTGG + Intronic
1054746676 9:68860835-68860857 GCTGGGACTCACCTCTAGGGAGG - Intronic
1057274721 9:93670257-93670279 GCTGGGCCTCCCCTGTAAGGTGG + Intronic
1059742125 9:117162252-117162274 GCAGGCACTCACCTCCAGGAAGG - Intronic
1059771316 9:117429160-117429182 GCTGGGATTCAGTTCTAGGCTGG - Intergenic
1061205150 9:129158681-129158703 GCTGGGACGCCTCTCTCGGGAGG - Intergenic
1061298362 9:129689559-129689581 GCTGGGCCTCAACTCTAGGCTGG + Intronic
1061484660 9:130914228-130914250 GCTGGGACAGACCCCTCGGGAGG - Intronic
1062357192 9:136170560-136170582 GCTGGGGCCCACCTCTCTGGGGG - Intergenic
1186517469 X:10176634-10176656 GCCGGGACTTGCCTCTAGGGTGG + Intronic
1199788537 X:151128000-151128022 GCTGTTACTCACCTCTAGAAAGG - Intergenic
1200227880 X:154429125-154429147 CCTGGGACCCAGCTCCAGGGCGG - Exonic