ID: 1054748637

View in Genome Browser
Species Human (GRCh38)
Location 9:68881745-68881767
Sequence TTGTCTAGGAATAAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 342}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054748637_1054748650 30 Left 1054748637 9:68881745-68881767 CCTTCTTCCTTATTCCTAGACAA 0: 1
1: 0
2: 2
3: 33
4: 342
Right 1054748650 9:68881798-68881820 AGAGCATTCCCATCTCTGCTTGG No data
1054748637_1054748643 3 Left 1054748637 9:68881745-68881767 CCTTCTTCCTTATTCCTAGACAA 0: 1
1: 0
2: 2
3: 33
4: 342
Right 1054748643 9:68881771-68881793 CCTCCCAAGGCAAAGCCAAAGGG No data
1054748637_1054748639 -10 Left 1054748637 9:68881745-68881767 CCTTCTTCCTTATTCCTAGACAA 0: 1
1: 0
2: 2
3: 33
4: 342
Right 1054748639 9:68881758-68881780 TCCTAGACAAACACCTCCCAAGG No data
1054748637_1054748641 2 Left 1054748637 9:68881745-68881767 CCTTCTTCCTTATTCCTAGACAA 0: 1
1: 0
2: 2
3: 33
4: 342
Right 1054748641 9:68881770-68881792 ACCTCCCAAGGCAAAGCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054748637 Original CRISPR TTGTCTAGGAATAAGGAAGA AGG (reversed) Intronic
901300418 1:8196337-8196359 TTGGCTAGGAAGAAAGAGGAAGG + Intergenic
902169873 1:14601007-14601029 TTGTGTAGGAAAAAAGAACAAGG - Intronic
902893813 1:19464865-19464887 TTGTCTAGGGATGGGGAACAAGG + Intronic
903373958 1:22854104-22854126 TTGTCTAGGAAGGGGGAAGATGG + Intronic
904993009 1:34608879-34608901 TTGAATAGGAATAAGGAAAACGG - Intergenic
905685668 1:39905827-39905849 TGGTCCAGGAAAAAGGGAGATGG + Intergenic
906443928 1:45876782-45876804 TTGTATAGGTGTAAGGAAGTCGG + Intronic
906671662 1:47659757-47659779 GTGTCTACAAATAAGGAAAATGG - Intergenic
906874096 1:49516996-49517018 TTGTATAGGAATAATGTAAACGG - Intronic
907217946 1:52882191-52882213 TTATTTAGAAATAAGGAAGTTGG - Intronic
908017699 1:59861601-59861623 TTTTCTATGGATAAGGAATATGG + Intronic
908255804 1:62302666-62302688 CTGTCTATGAACCAGGAAGAGGG + Intronic
908275186 1:62463488-62463510 ATGTCCAGAAATAAGGTAGACGG + Intronic
908901107 1:68957573-68957595 CTGTCTATGAACAAGGAAGTAGG + Intergenic
909408552 1:75321400-75321422 TCATCTAGAAATCAGGAAGAGGG - Intronic
909750238 1:79150502-79150524 TTTACTAGTAAGAAGGAAGAAGG - Intergenic
910386757 1:86692563-86692585 TAGGCCAGGAAGAAGGAAGAAGG + Intergenic
910664616 1:89710831-89710853 ATGTCTAGGATTAAGCCAGAGGG - Intronic
911366898 1:96949510-96949532 CTGTCTATGAATCAGGAAGTGGG - Intergenic
912047711 1:105480827-105480849 TTGGCAAGAAAGAAGGAAGAAGG - Intergenic
915014312 1:152719075-152719097 TTGTCTGGGCAGAAGGAAGAAGG + Intergenic
917908417 1:179613609-179613631 CTATCTATGAATGAGGAAGAAGG - Intronic
918029106 1:180786332-180786354 CTGTCTAGGAATAAGGAAAATGG - Intronic
918085827 1:181244519-181244541 TAGTCAAGGAATTAGGAAGGCGG - Intergenic
918200587 1:182262597-182262619 TTATCTAGGAACAAGCATGACGG + Intergenic
920145097 1:203853499-203853521 TTGTGAAGGAATAAGCATGATGG + Exonic
921820203 1:219608506-219608528 TTGTGAAGGAATAAGCATGATGG - Intergenic
922404907 1:225302536-225302558 ATATCTGGAAATAAGGAAGAAGG + Intronic
924261510 1:242236147-242236169 CTGTCTATGAACAAGGAAGTGGG + Intronic
924446794 1:244140341-244140363 TTGTTTACAAATAATGAAGAAGG - Intergenic
1065186768 10:23175903-23175925 TGGTCCAGGAATAAGGCAGTTGG + Intergenic
1065186772 10:23175922-23175944 TTGGCCAAGGATAAGGAAGATGG + Intergenic
1067165735 10:43865129-43865151 TTGTTTTTCAATAAGGAAGATGG - Intergenic
1069073420 10:64013493-64013515 TTGTCTATGAACCAGGAAGCAGG + Intergenic
1069203291 10:65650820-65650842 TTGTTTAGGAATAAGGAAAAAGG - Intergenic
1069412413 10:68167031-68167053 TTGTCCAGGAAAAAAAAAGATGG + Intronic
1070653020 10:78251874-78251896 ACGTCTATGAATAAGGAAGTGGG - Intergenic
1070679275 10:78437313-78437335 TAGTCTGGGAATCAGGAAGCTGG - Intergenic
1071544047 10:86514487-86514509 TTGTGAAGGAGGAAGGAAGATGG + Intronic
1071950076 10:90693172-90693194 TTGACAAAGAAAAAGGAAGATGG + Intergenic
1071977363 10:90968350-90968372 TTCTCTAGAAATCATGAAGAAGG - Intergenic
1072280144 10:93858399-93858421 TCCTCTAGGATTAAGGAAGGAGG - Intergenic
1072292091 10:93973407-93973429 TTGTCCATGTATGAGGAAGAGGG + Intergenic
1072543348 10:96414897-96414919 TGGTCTGGGAACAAGGAGGAGGG - Intronic
1073028793 10:100508329-100508351 TTGTCTAGGACAAAAAAAGAGGG + Intronic
1073153647 10:101329267-101329289 TTGTCTTTGGATAAGCAAGAGGG + Intergenic
1074008760 10:109456081-109456103 TTGTCAGGGAAGAAGGAATAAGG + Intergenic
1074411919 10:113235839-113235861 TTGTGTAGGAATATGGACAATGG - Intergenic
1075142219 10:119849134-119849156 CTGGCTATGAATATGGAAGAAGG + Intronic
1075338966 10:121630259-121630281 CTGTCTCGGAAGAAGGAAGGAGG + Intergenic
1075945660 10:126430885-126430907 TTTTCTAGGAATATCTAAGAAGG + Intronic
1076160890 10:128243359-128243381 TTTCCTAGGAAACAGGAAGAAGG + Intergenic
1076942574 10:133619585-133619607 TTGGCTAGAAACAAAGAAGATGG - Intergenic
1078490177 11:11761016-11761038 CTGTCTTGGAAGAAGGAGGAAGG - Intergenic
1079548128 11:21660204-21660226 TTGTCTATGAACTAGGAAGAAGG - Intergenic
1080193477 11:29579472-29579494 TTGACAAGGAATAAGGCAGAAGG - Intergenic
1080249397 11:30216028-30216050 TTGACAAGGAAAAGGGAAGATGG + Intergenic
1080456637 11:32425477-32425499 TTGTTTAGGAGTAGGAAAGAGGG + Intronic
1081237700 11:40665201-40665223 TTTTCTAGGAATAAGGTAAAGGG - Intronic
1081388403 11:42500524-42500546 TTGTCCAGATATAAGGAGGAGGG + Intergenic
1082163334 11:48908852-48908874 TTGATAAGGCATAAGGAAGAGGG - Intergenic
1085096406 11:73763971-73763993 TTGTCTATGAACCAGGAAGTGGG - Intergenic
1085588448 11:77733861-77733883 TTGTTTAGGAATGAAAAAGATGG - Intronic
1086052758 11:82613459-82613481 TTGGCAAGGAAAAGGGAAGATGG - Intergenic
1086192350 11:84094589-84094611 TTATCTATGAACCAGGAAGAGGG - Intronic
1086217825 11:84405054-84405076 TATTCTTGTAATAAGGAAGAGGG + Intronic
1086238712 11:84662998-84663020 TTGGCTAGGAAATTGGAAGAGGG - Intronic
1086805922 11:91241987-91242009 CACTCAAGGAATAAGGAAGATGG + Intergenic
1087219846 11:95535058-95535080 TTGTCAAGGTTTAAGGAAGGTGG + Intergenic
1087980028 11:104600616-104600638 TTTTCCAGGGATTAGGAAGAAGG + Intergenic
1088969620 11:114761534-114761556 TTGGCTAGGGACAAGGAAAAGGG - Intergenic
1089355742 11:117851665-117851687 TTCTTTAGGAATAAAGAAAATGG - Intronic
1089514790 11:119025615-119025637 TTGGCTAGGGGTAAGGCAGAAGG + Intronic
1090683817 11:129092597-129092619 TTGTATATAAATAAGTAAGATGG - Intronic
1090886452 11:130881056-130881078 CTGTCTATGAACAAGGAAAAGGG + Intronic
1090936511 11:131347705-131347727 TTGTGTAGGAAGAAGAGAGAAGG + Intergenic
1091593112 12:1857098-1857120 ATGTGTAGGAAGAAGGAAGAAGG + Intronic
1091661703 12:2389006-2389028 TTGTCTAGGAAGAATGACTAGGG + Intronic
1092363353 12:7856944-7856966 TTGTCTTAGAATTAAGAAGATGG + Intronic
1092899799 12:13047687-13047709 TTTTCAAAGAATAAGGGAGAGGG - Intronic
1093876940 12:24359713-24359735 TTATCAAGGGATAAGGAAGAAGG + Intergenic
1094104095 12:26790852-26790874 TTGTTTAGGTATAAAGAAGGAGG - Intronic
1095646485 12:44554436-44554458 TTGTCTAGGCTTAGGGGAGAGGG + Intronic
1095758291 12:45795921-45795943 TTTTCTAGGAATAAAAGAGAGGG - Intronic
1096762727 12:53856148-53856170 TTGACTAGTACTAAGGAAGCTGG + Intergenic
1096841760 12:54384294-54384316 TTAACTAGAATTAAGGAAGATGG + Intronic
1096896233 12:54822958-54822980 TTGGCAAGGAAAAGGGAAGATGG - Intergenic
1097470258 12:59981704-59981726 TCATCTATGAATTAGGAAGAGGG + Intergenic
1098296122 12:69005946-69005968 TAGTTTAGGAACAAGGAAAATGG - Intergenic
1098829335 12:75341104-75341126 TTTTCTAGGAAAAAAGAAAAAGG - Intronic
1099193273 12:79583082-79583104 TGGTCTAAGAATGGGGAAGAAGG + Intronic
1099272394 12:80527118-80527140 TAGTCAAGAAATAAGAAAGATGG - Intronic
1099744602 12:86686374-86686396 TTGAATAGGAGTAAGGAAGAGGG + Intronic
1100975801 12:100121418-100121440 TTGCCCAGGAATGAGGCAGAAGG + Intronic
1101021108 12:100554762-100554784 TTCTCCAGGAAGAAGGAAGCAGG + Intronic
1106502359 13:30341066-30341088 GTATCTTGGAATTAGGAAGATGG - Intergenic
1106572523 13:30940186-30940208 TAGTCTTGGAAGATGGAAGAAGG + Intronic
1107315209 13:39123989-39124011 TAGTCCAGGAAGATGGAAGAAGG - Intergenic
1108031373 13:46233198-46233220 TTGAGTAGAAATGAGGAAGATGG - Intronic
1109512392 13:63396600-63396622 ATGTCTAGGAAGAAGGAGGTAGG - Intergenic
1111458201 13:88510388-88510410 TTGTCTGTGAATAAAAAAGAGGG + Intergenic
1111477450 13:88770865-88770887 TTGTGTAGAAATAAGTAAAATGG - Intergenic
1114169026 14:20253201-20253223 TTGCCAAGGGATAAGAAAGAAGG + Intergenic
1114557075 14:23568222-23568244 TTGACTAGAAAAAAAGAAGAGGG + Exonic
1114846671 14:26331251-26331273 TAGTCAAGGAATAAGGAACAGGG - Intergenic
1115503325 14:34068520-34068542 TTGTTTATGAATAAGAAAGTGGG - Intronic
1116023819 14:39492154-39492176 TTTTCTAGGCAAATGGAAGATGG - Intergenic
1116586312 14:46709239-46709261 TTGTCTACGAACTGGGAAGAGGG + Intergenic
1119008493 14:70957601-70957623 TTGTCTAGGGCTAAGGAGGATGG + Intronic
1119583004 14:75804457-75804479 TTCTCTAGGATTGAGGCAGATGG + Intronic
1120113835 14:80590508-80590530 CTGTTTAGGAATAAAGATGAAGG + Intronic
1120439777 14:84521252-84521274 CTGCACAGGAATAAGGAAGAGGG + Intergenic
1120614824 14:86690306-86690328 CTGTCTATGAATCAGGAAGAAGG + Intergenic
1121607385 14:95251183-95251205 TTGTCTAAGAACCAAGAAGATGG - Intronic
1123205323 14:106707140-106707162 TAGGCTAGGCATTAGGAAGAAGG - Intergenic
1123210367 14:106754407-106754429 TAGGCTAGGCATTAGGAAGAAGG - Intergenic
1123390433 15:19866097-19866119 TTTTGTAGGGAAAAGGAAGAGGG + Intergenic
1123774362 15:23564273-23564295 TTATCAAGGAAAAATGAAGAAGG - Intergenic
1124191289 15:27579344-27579366 TGGTCTAGGGATAAGGTAAATGG + Intergenic
1124633173 15:31348863-31348885 CTGTCTACGAACCAGGAAGAGGG - Intronic
1125920066 15:43520169-43520191 GTGTCTAGAAATAAGGAAATAGG - Intronic
1125990618 15:44103272-44103294 TTCTCCAGAAAGAAGGAAGAAGG + Intronic
1126405679 15:48320310-48320332 TTGGCGAGGAAGACGGAAGAAGG + Intergenic
1126777737 15:52113569-52113591 TTGTCTATGAACCAGGAAGCAGG - Intergenic
1126834488 15:52645971-52645993 TTGTGTAGGATTAATGAAGCTGG - Intronic
1128357479 15:66938239-66938261 TTGTGTAGGAGTGAGGAATACGG - Intergenic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1130689571 15:86069946-86069968 CTGTCTATGAACCAGGAAGAGGG - Intergenic
1130830998 15:87599425-87599447 TTGTCAAGGATTAAGGCAGGAGG - Intergenic
1134565256 16:15246467-15246489 CTGTCTATGAACTAGGAAGAAGG - Intergenic
1134737240 16:16510231-16510253 CTGTCTATGAACTAGGAAGAAGG + Intergenic
1134930278 16:18201929-18201951 CTGTCTATGAACTAGGAAGAAGG - Intergenic
1137264221 16:46855481-46855503 TTATCTGGGAAGAAGGGAGAGGG - Intergenic
1138317484 16:56082647-56082669 TTGTCTATGAACCAGGAAGAGGG - Intergenic
1138408897 16:56822141-56822163 GTGGCTAGGAGGAAGGAAGAAGG + Intronic
1139726184 16:68900852-68900874 ATGTCTAGGAAGAAGGAAATAGG + Intronic
1140255212 16:73329902-73329924 TTGTTTTGGAATAATGAATATGG - Intergenic
1144427946 17:15162057-15162079 ATGACTAGGAATAAGAAAGATGG + Intergenic
1145290361 17:21540313-21540335 TTGCCTAGGAATGAGCATGAGGG + Intronic
1146016963 17:29241465-29241487 TTGTGTGGGAATAAGCAGGATGG - Intergenic
1150751372 17:67865853-67865875 TTGTCCAGAAGTAAAGAAGAGGG + Intronic
1150965552 17:69963937-69963959 TTGTTAAAGAGTAAGGAAGATGG - Intergenic
1153690057 18:7583212-7583234 TTTCCTAGAAATAAGGAAAAAGG + Intronic
1154281067 18:13003873-13003895 TTGTCTGGGAGTGAGGCAGATGG + Intronic
1154301591 18:13198307-13198329 TTTTCTAAGAATAATCAAGAAGG - Intergenic
1154530967 18:15344738-15344760 TTTTGTAGGGAAAAGGAAGAGGG - Intergenic
1155989183 18:32261477-32261499 TTGTCTAAGACTAAAGAACAGGG - Intronic
1156717546 18:40029128-40029150 TTGTGTAGGAATGAGGATCAAGG + Intergenic
1157015955 18:43713052-43713074 TCTTCAAGGAAGAAGGAAGAAGG + Intergenic
1157577657 18:48754471-48754493 TTGTGCAGGAAGAAGGAAAAGGG + Intronic
1157918797 18:51695397-51695419 TTGACAAGGAAAAGGGAAGATGG + Intergenic
1158155086 18:54416832-54416854 TTGTCCAAGAATAAAAAAGAAGG - Intergenic
1159107959 18:64025600-64025622 TTGGGAAGGGATAAGGAAGAGGG + Intergenic
1159910260 18:74138902-74138924 TTCTCTAGAAGTAGGGAAGACGG - Intronic
1160367811 18:78343771-78343793 TTGGGTAGGTAAAAGGAAGAAGG - Intergenic
1161935871 19:7371953-7371975 TTGTCTTGGGATGAGGAAGGAGG - Intronic
1164463500 19:28468268-28468290 TTGTCTTGCTATAAAGAAGAAGG - Intergenic
1164813413 19:31175902-31175924 TGGTCTGGGAATCAAGAAGATGG + Intergenic
1165839233 19:38777516-38777538 TTGTCTCAAAATAAAGAAGAGGG + Intergenic
926339877 2:11896133-11896155 TGGTGTAGGAAGAAGGAGGATGG + Intergenic
927316581 2:21690216-21690238 TAGTCTAGGAATAGGTAAGAGGG + Intergenic
927947343 2:27144150-27144172 TTGACAAGGAATAAAGGAGAGGG - Intergenic
928534281 2:32225044-32225066 TTTCCTAGGAGTAAGGAAAAGGG - Intronic
928644427 2:33336722-33336744 TTTGCTCAGAATAAGGAAGAAGG + Intronic
928790432 2:34944973-34944995 TTGTTTAGGTATAAGGAAAAAGG + Intergenic
929706113 2:44213926-44213948 TTCTTTATGAATGAGGAAGAAGG - Intronic
929734099 2:44527056-44527078 TTGTCAAGGAATAAGGGGGCTGG - Intronic
929897652 2:45975871-45975893 TAGTCTAGGTAAGAGGAAGAAGG + Intronic
929960997 2:46496335-46496357 TGGTCTAGGAAAGAGGAAGGAGG - Intronic
931036881 2:58253730-58253752 TTGTTTAAGAAAAAGGAAAAAGG + Intergenic
932116734 2:69057162-69057184 TTGTCTATGAATAAGAGAGCAGG - Intronic
932475265 2:72001933-72001955 TCGTCTAGGAAAAATGAAGCAGG + Intergenic
933222823 2:79710413-79710435 CTGTCTAGGAATATGCATGAAGG + Intronic
933447835 2:82404230-82404252 ATGCCTAGGTATAAAGAAGAAGG - Intergenic
935016304 2:99185678-99185700 TTGCCTAGGAATTAGGAGAATGG + Intronic
935463650 2:103368765-103368787 CTGTCTATGAACCAGGAAGAGGG - Intergenic
936001750 2:108838404-108838426 TTGTATAGCAATCAGGAAAATGG - Intronic
937516097 2:122656938-122656960 TTTTCTGAGAATAAGCAAGAGGG + Intergenic
940070168 2:149678112-149678134 TTCTCAAGGAACACGGAAGAGGG - Intergenic
940290180 2:152070649-152070671 TTGGCTAGCAAAAAGGAAGTTGG + Intronic
940395857 2:153191110-153191132 TTGACTAGGAATAGTGAAAATGG + Intergenic
940524196 2:154791269-154791291 TGGTCTAGGAAAGAGGAAGATGG + Intronic
940543667 2:155055028-155055050 TTGACAAAGAAAAAGGAAGATGG + Intergenic
941036549 2:160575138-160575160 TTGACAAATAATAAGGAAGAGGG - Intergenic
941535774 2:166721134-166721156 TGGTGTAGGAAAAAGGAGGAGGG - Intergenic
942275956 2:174324030-174324052 TTGCCTCAAAATAAGGAAGAGGG + Intergenic
943279385 2:185911804-185911826 TTTTTAAGGAATAAGGAAAAGGG - Intergenic
946120524 2:217509035-217509057 TTGTCTATGAATGAGGAGGTAGG + Intronic
946796805 2:223362921-223362943 GTGTCTAGGAATCAGAAAGTGGG + Intergenic
947074835 2:226331201-226331223 TTGTCTAGGTATAAGAATTAAGG + Intergenic
947077242 2:226358463-226358485 TTGACTAGTAATCAGGAAGTAGG + Intergenic
947250174 2:228093919-228093941 TTGCCTAGGCCTAAGGAGGATGG + Intronic
947446035 2:230163273-230163295 TTGGCAAGGAAAAGGGAAGATGG + Intergenic
947620900 2:231590480-231590502 TTGTCTGACACTAAGGAAGAAGG + Intergenic
948740817 2:240044628-240044650 TTATTTAGGAAAAAGGCAGAGGG + Intergenic
1172168395 20:32913274-32913296 CTGTCTATGAATCAGGAAGTAGG - Intronic
1172917212 20:38452083-38452105 TTGGGTAGGAATAAGGAGGGGGG - Intergenic
1174628764 20:51938161-51938183 TTGTCTCTGAAGAGGGAAGATGG - Intergenic
1176766443 21:13023722-13023744 TTTTGTAGGGAAAAGGAAGAGGG + Intergenic
1177903868 21:26951472-26951494 ATGTCTAGTAAAAAGGAAGGGGG + Intronic
1179585026 21:42369358-42369380 CTGTCTAGGAAGGAGGAAGCAGG + Intergenic
1180342102 22:11627855-11627877 TTGTCTAGGAGAAAGGAGGCTGG + Intergenic
1180513572 22:16118170-16118192 TTTTGTAGGGAAAAGGAAGAGGG + Intergenic
1181916787 22:26287841-26287863 TTGTGTATGATTAAGGAAAAGGG + Intronic
1183291956 22:37008147-37008169 CTGTGTAGGAAAAAGGAGGAAGG + Intergenic
949364346 3:3264503-3264525 TTAGCTCGGAATAAGGAAGCTGG + Intergenic
949523610 3:4880268-4880290 TTTTCTAAGAATAAGGAAATGGG - Intronic
951081368 3:18454003-18454025 TTTTTTAGAAATAAGGAAAATGG + Intergenic
951577829 3:24131730-24131752 CTGTCTATGAATCAGGAAGCAGG + Intronic
951854891 3:27185386-27185408 TTGGGTAGGAATGTGGAAGATGG + Intronic
951989808 3:28664140-28664162 CTTTCTAGGAATAAGAAACAAGG - Intergenic
952651717 3:35735631-35735653 TTATCTTGGCATAAGGGAGATGG - Intronic
954800996 3:53186779-53186801 TTTTCTAGGGAGAGGGAAGAAGG - Intronic
957450733 3:80378605-80378627 CTGTCTATGAATCAGAAAGAAGG - Intergenic
957471615 3:80666247-80666269 TTCTCTAGGAAGAAAGAAGAAGG - Intergenic
958733254 3:97980456-97980478 TGTTGTAGGAATAAGGAATAAGG - Intergenic
958894037 3:99810615-99810637 TTGCCAAGGAGTAAGGGAGAGGG + Intergenic
959191032 3:103112114-103112136 TTGACTCTGAAGAAGGAAGAAGG + Intergenic
959508965 3:107188618-107188640 TTGTCTATGAACTAGGAAGTGGG - Intergenic
960641396 3:119827317-119827339 ATCTCTATGAATAATGAAGAGGG - Intronic
964028130 3:152103089-152103111 CTGTCTAGGAATATGTAATACGG - Intergenic
964716816 3:159731640-159731662 TTGTCTTGGAGTCAGGAGGAAGG + Intronic
964830385 3:160877875-160877897 TTGGCAAGGAAGAGGGAAGATGG + Intronic
966471346 3:180292814-180292836 TTGTTTAGAAATCAGGAACAAGG + Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967629236 3:191723913-191723935 TTGACTTGGAAGATGGAAGAAGG - Intergenic
968450358 4:673239-673261 TTGTGCAGGGATAAGGAAAATGG - Intronic
969927305 4:10596928-10596950 TTGTCAAGAAATAAGGAAAATGG + Intronic
970076661 4:12229635-12229657 CTGTCTATGAATAAGAAAGCAGG + Intergenic
970114033 4:12672921-12672943 TTGTCTAGGAATAAGGGCTAAGG - Intergenic
970669570 4:18380529-18380551 CAGTCTAGGAAAAAGGAACAGGG + Intergenic
971318902 4:25589389-25589411 TTTTCCAGGAATCTGGAAGAGGG + Intergenic
972053198 4:34766020-34766042 TTTCCTTGGAATAAGGAAGAAGG - Intergenic
972662541 4:41130242-41130264 TTATCTAGGAATGAGGAGAAGGG + Intronic
972744958 4:41923771-41923793 TTGGCAAGGAAAAGGGAAGATGG - Intergenic
972802572 4:42492558-42492580 CTGTCTATGAACCAGGAAGAAGG + Intronic
973249410 4:48046130-48046152 TTGTCCAGGTGTAGGGAAGAAGG - Intergenic
974570306 4:63637771-63637793 TGATTTAGGAGTAAGGAAGAAGG - Intergenic
974885723 4:67814635-67814657 TTGTTTAGGTGTAAGGAAGGGGG - Intergenic
976336638 4:83895460-83895482 TTGGCTATGAAAAAGAAAGATGG - Intergenic
977444267 4:97109565-97109587 TTGTAGAAGAATATGGAAGAAGG + Intergenic
978416178 4:108478633-108478655 TTTTTTAGAAATAAGTAAGAAGG - Intergenic
978715075 4:111832222-111832244 TTGTCTGGGCTAAAGGAAGATGG + Intergenic
980187507 4:129480621-129480643 GTGTTTAGGTATAAGAAAGAGGG - Intergenic
980207706 4:129742763-129742785 TGTTCTAGGCATAGGGAAGAGGG + Intergenic
980436088 4:132776005-132776027 TTGTCTATAAACTAGGAAGATGG - Intergenic
981504900 4:145488945-145488967 TTGCATAGGCAGAAGGAAGAGGG + Intronic
982804924 4:159751548-159751570 TAGACTAAGAAAAAGGAAGAAGG - Intergenic
983682271 4:170367274-170367296 TTGCCTAGGGATGAGGAAGTGGG - Intergenic
983924732 4:173387919-173387941 TTTTCTAGTAAGAAGGAAAAAGG - Exonic
984414176 4:179435756-179435778 TTGTCTCACAACAAGGAAGAAGG + Intergenic
985000928 4:185481853-185481875 TTCACTAGTAATAAGTAAGATGG - Intergenic
985263632 4:188138181-188138203 TTGACTAGGAGAAAGGAAGGTGG + Intergenic
986425911 5:7631343-7631365 TGCTGTAGGAATAAAGAAGACGG - Intronic
986643376 5:9893156-9893178 TTGTAGGGGAAGAAGGAAGAAGG - Intergenic
989189876 5:38660335-38660357 TTGACAAGGAAAACGGAAGAAGG - Intergenic
989309801 5:40001611-40001633 ATGTCTAGGGAAATGGAAGATGG - Intergenic
991202891 5:64014769-64014791 GTGTCTATGAAGAAGGAAGAGGG - Intergenic
991952996 5:71965068-71965090 TGGCCTGGGAAGAAGGAAGAAGG + Intergenic
992097006 5:73372286-73372308 TTGCCTAGGAAAAAGGCAGGAGG + Intergenic
992153322 5:73927769-73927791 ATTTCTAGAAATATGGAAGAGGG + Intronic
993626396 5:90229712-90229734 TTGGCCAGAAATAAGGATGAGGG - Intergenic
993677754 5:90837873-90837895 TAGTCAAGGAAAAAGCAAGATGG - Intronic
995364598 5:111343781-111343803 TTGTATAGGGATAAGGCAGAAGG + Intronic
996180614 5:120414834-120414856 TTTTCTAAGAATAAGGAAGCAGG - Intergenic
996567931 5:124901025-124901047 TTGTCGTGGAATAATGATGATGG + Intergenic
996868149 5:128153819-128153841 TAGTCTAGCAAAAAGGAAGGGGG - Intronic
997173176 5:131745914-131745936 TTTTCTAGGAGTAAGGTGGAGGG + Intronic
998138546 5:139687315-139687337 CTGTGCAGGAAGAAGGAAGAAGG + Intergenic
998375973 5:141691063-141691085 TGGTCTAGGAAAGAGGTAGATGG - Intergenic
998375994 5:141691195-141691217 TGGTCTAGGAAAGAGGTAGATGG - Intergenic
999026563 5:148239385-148239407 TTCACTAGGTATAAGAAAGATGG - Intergenic
999671508 5:153962718-153962740 GTGTCTATGAATCAGGAAGCTGG - Intergenic
1000841198 5:166220627-166220649 TTGTCTATGAACAAGGAAGCAGG - Intergenic
1000954493 5:167526704-167526726 TTGAATAGGAATTAGAAAGAAGG - Intronic
1004871742 6:19912139-19912161 TTGTCTAGTAATTGAGAAGATGG - Intergenic
1005040867 6:21598879-21598901 TTGTCTTGGAATCTGAAAGAGGG + Intergenic
1005084257 6:21988082-21988104 ATGACTAGGAATGAGGATGAAGG - Intergenic
1005414035 6:25582610-25582632 TAGCCTAGCAAGAAGGAAGAGGG - Intronic
1005969252 6:30748625-30748647 TTGCCTTGGAATAAGGATGTTGG - Intergenic
1008638010 6:53431947-53431969 CTGTCTATGAACAAGGAAGCAGG - Intergenic
1008949283 6:57137759-57137781 TTGCCTAGGGATGAGGAAGATGG - Intronic
1009550368 6:65084878-65084900 TTGTGGAGGAATAAGAAAGAGGG + Intronic
1009565430 6:65306056-65306078 TTGTGAAGGAATAAGCATGATGG + Intronic
1010058804 6:71598019-71598041 TCCTTCAGGAATAAGGAAGATGG + Intergenic
1010665482 6:78625143-78625165 TTTTCTAGGAACTAGAAAGAGGG - Intergenic
1010672999 6:78709063-78709085 CTGTCTATGAATGAGGAAGTGGG - Intergenic
1011796441 6:90958727-90958749 TTGTCAAGGATTGAGGCAGAAGG - Intergenic
1012160156 6:95874065-95874087 TTGCCTGGGAAGAAAGAAGAAGG + Intergenic
1012212827 6:96544373-96544395 TTTGCTGGGGATAAGGAAGAGGG - Intronic
1012252864 6:96998074-96998096 CAGGCTAGGAATAAGGCAGAAGG - Intronic
1012690054 6:102299194-102299216 TTCTTTAGAAATAAGGATGAGGG - Intergenic
1013777890 6:113699362-113699384 TTGTAAAGGAAAAATGAAGAGGG + Intergenic
1013848376 6:114482884-114482906 TTGGCTAGGAATCAGAGAGAGGG - Intergenic
1014269393 6:119319868-119319890 TTTTCAAGGCAGAAGGAAGAGGG - Intronic
1015425854 6:133066345-133066367 TTGTCTAGGAACAAAGATTATGG + Intergenic
1015786384 6:136923618-136923640 TTGTCTTGGACAGAGGAAGATGG + Intronic
1015866746 6:137734735-137734757 TTGTTTAATAATGAGGAAGATGG - Intergenic
1015935129 6:138401582-138401604 TTGTCTAGGCATAGGGAATGGGG + Intergenic
1016145913 6:140673248-140673270 TTGTCTAGGAATGGAGAATATGG + Intergenic
1016773488 6:147878236-147878258 CTATCTATGAATCAGGAAGAGGG - Intergenic
1017015252 6:150094667-150094689 TTGTCTTGGAAGAAGGACTATGG + Intergenic
1017857066 6:158359153-158359175 TTTTCTAGGTAAGAGGAAGAGGG - Intronic
1017945809 6:159095546-159095568 TTGTCAAAGAACAGGGAAGAAGG + Intergenic
1018730835 6:166649247-166649269 TGATCTAAGAAGAAGGAAGAGGG - Intronic
1020464235 7:8458490-8458512 TTCTTAAGGAATAAGGATGAGGG - Intronic
1020732893 7:11906905-11906927 TTGTCAGGGAATTGGGAAGAGGG - Intergenic
1021254748 7:18377157-18377179 CTGTCTATGAATCAGGAAGCAGG - Intronic
1021645436 7:22785021-22785043 TTGTCATGGAATAAGGAACAAGG - Intergenic
1021808956 7:24384049-24384071 CTGTCTATGAATCAGGAAGCAGG + Intergenic
1022227968 7:28382945-28382967 TTGAGTAGGAATAGGGAACAAGG + Intronic
1023202072 7:37709462-37709484 TCTTCTAGGAATTATGAAGAGGG - Intronic
1023771486 7:43560595-43560617 TATTTTGGGAATAAGGAAGATGG - Intronic
1027007164 7:74704924-74704946 TTGTCTAGTAAGATGGAATATGG - Intronic
1027719058 7:81715233-81715255 TGGTGTAGGAAGAAGGAAAAAGG - Intronic
1028583934 7:92434696-92434718 TTGTCTTTGAAGATGGAAGAAGG + Intergenic
1031149209 7:118033449-118033471 TTGTCAAGGGATAAGGTAGCAGG - Intergenic
1031424170 7:121585597-121585619 TTGACAAAGAAAAAGGAAGATGG - Intergenic
1031774187 7:125885710-125885732 CTGTCTCTGAATAAGGAAGTAGG + Intergenic
1032378173 7:131445509-131445531 TTGTGTAGGAATGGAGAAGAAGG - Intronic
1034180168 7:149130911-149130933 TTGGTTAGGGGTAAGGAAGAGGG + Intronic
1034505882 7:151490550-151490572 TTCTGTAAGAATAAGGAACAGGG + Intronic
1035994262 8:4528320-4528342 TTTTATAGGAATAAAGAAGGTGG + Intronic
1036968890 8:13331895-13331917 GCGTCTAGGAAAAAGAAAGAAGG - Intronic
1038645558 8:29358792-29358814 TTGTCTAAGAGAAAGGAATAAGG - Intergenic
1039309990 8:36307058-36307080 TAGACTAGGAACAAGAAAGAAGG + Intergenic
1040506720 8:48055724-48055746 TTGTTTAGGTCTAAGGGAGATGG - Intronic
1041008248 8:53516401-53516423 TTATCTTGGAAGAAGGAAGGAGG + Intergenic
1041182252 8:55260820-55260842 TTGGCAAGGAAAAGGGAAGATGG + Intronic
1041285357 8:56255494-56255516 TTATCTAGGAATGGGGAAGAGGG + Intergenic
1041313147 8:56536710-56536732 TTGTCTACAAACCAGGAAGAGGG - Intergenic
1041601075 8:59717902-59717924 TTGGCAAGGAATAGGGAAGATGG - Intergenic
1042341377 8:67683667-67683689 TTGAATAGGCATAAAGAAGAGGG - Intronic
1042439518 8:68809864-68809886 TTGTGTAGGCATAATAAAGATGG + Intronic
1042831846 8:73038729-73038751 CTGACTATGAATAAGAAAGAAGG + Intronic
1043032558 8:75155643-75155665 TTTTCTAGAAATAATGAGGATGG + Intergenic
1043530955 8:81149387-81149409 TTTTCTATGAATAATGAATATGG + Intergenic
1044804025 8:95986634-95986656 TTGTCTAGGAACAAAGAAATAGG - Intergenic
1044864042 8:96551894-96551916 CTGTTTAAGAAAAAGGAAGAAGG - Intronic
1044920305 8:97162999-97163021 CTTTCTAGCAAGAAGGAAGATGG - Intergenic
1045099995 8:98834608-98834630 CTGTCTATGAATCAGGAAGTTGG - Intronic
1045100203 8:98836302-98836324 CTGTCTATGAATCAGGAAGTTGG - Intronic
1045400445 8:101811315-101811337 TTGGCTAGGAAGATGGAGGAAGG + Intronic
1045496113 8:102710290-102710312 TTTTCTAAGAAAAAGGAAGTAGG + Intergenic
1045752665 8:105504047-105504069 TTGTCAAGAAGTAAGGAACAGGG + Intronic
1045797112 8:106059028-106059050 TTGTCTAGCCTTGAGGAAGAGGG - Intergenic
1046301873 8:112304866-112304888 TTATCTTGGAACATGGAAGATGG - Exonic
1046334178 8:112761511-112761533 TTGACTAGGAAAATAGAAGAGGG - Intronic
1046468634 8:114638502-114638524 TTATTAATGAATAAGGAAGAGGG + Intergenic
1046725717 8:117671521-117671543 TGGTCTAAGCATCAGGAAGAAGG - Intergenic
1046794222 8:118353498-118353520 CTGTCTACAAATGAGGAAGAAGG + Intronic
1047021502 8:120779617-120779639 CTGACTAGGACAAAGGAAGAGGG + Intronic
1048550176 8:135426768-135426790 TTATTTAGGAATAAGAAGGAAGG + Intergenic
1048648411 8:136448209-136448231 CTGTCTGCAAATAAGGAAGAGGG - Intergenic
1050196374 9:3088243-3088265 TTGACAAGGAAAAGGGAAGATGG - Intergenic
1050302077 9:4269761-4269783 TTGTCTGAGAATAATAAAGAGGG + Intronic
1052194541 9:25695497-25695519 CTGTCTAGGGATAAGAAAAAGGG + Intergenic
1052233103 9:26178541-26178563 TTGTATTGGATTAAGTAAGAAGG + Intergenic
1052587944 9:30453038-30453060 TTGACTATGAATCAGGAAGTGGG - Intergenic
1054748637 9:68881745-68881767 TTGTCTAGGAATAAGGAAGAAGG - Intronic
1055128662 9:72749783-72749805 TTTTACAGGAATAAGAAAGATGG + Intronic
1056164496 9:83928136-83928158 TTGAGAAGGAATGAGGAAGATGG + Intergenic
1056274041 9:84975246-84975268 TGTCCTTGGAATAAGGAAGATGG + Intronic
1061663598 9:132147363-132147385 TTGTCTAGGAAGGAGGAAGGGGG - Intergenic
1185938519 X:4286041-4286063 CTGTCTATGAATCAGGAAGCGGG + Intergenic
1186096006 X:6102476-6102498 CTGTCTATGAATCAGGAAGTGGG + Intronic
1186801248 X:13094230-13094252 TTGACTAGGAAAAGGGAAAAAGG - Intergenic
1187201805 X:17141177-17141199 TTGACTAGGAAAAAGCATGAGGG - Intronic
1187643645 X:21322135-21322157 TTGCCAAGGATTTAGGAAGAGGG - Intergenic
1188929260 X:36086357-36086379 TTGTATAGGAGCATGGAAGAGGG - Intronic
1189710403 X:43805429-43805451 TTGTCTAGGAAGGGGAAAGAGGG - Intronic
1190434495 X:50409925-50409947 TTGTCTATGAACCAGGAAGTGGG + Intronic
1193407477 X:81120584-81120606 TGTTTTAGGAATAAGGAAGGCGG + Intronic
1193866810 X:86742176-86742198 TTGTCTATAAATAAATAAGAAGG + Intronic
1194282094 X:91965917-91965939 TTACCAAGGAAGAAGGAAGAAGG + Intronic
1196003242 X:110808723-110808745 ATGACTAGGAATAACTAAGATGG - Intergenic
1198256007 X:134924965-134924987 TTGCCAAGGAAGAAGGAAGAAGG + Intergenic
1198324108 X:135550459-135550481 GTGTCTAGTAATAAAGGAGACGG + Intronic