ID: 1054748837

View in Genome Browser
Species Human (GRCh38)
Location 9:68883886-68883908
Sequence TATCCTTTCCCCATTGTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 296}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054748837_1054748839 1 Left 1054748837 9:68883886-68883908 CCACACACAATGGGGAAAGGATA 0: 1
1: 0
2: 4
3: 44
4: 296
Right 1054748839 9:68883910-68883932 TCTCTTTAAGAAATGATGTTGGG No data
1054748837_1054748838 0 Left 1054748837 9:68883886-68883908 CCACACACAATGGGGAAAGGATA 0: 1
1: 0
2: 4
3: 44
4: 296
Right 1054748838 9:68883909-68883931 GTCTCTTTAAGAAATGATGTTGG No data
1054748837_1054748840 9 Left 1054748837 9:68883886-68883908 CCACACACAATGGGGAAAGGATA 0: 1
1: 0
2: 4
3: 44
4: 296
Right 1054748840 9:68883918-68883940 AGAAATGATGTTGGGAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054748837 Original CRISPR TATCCTTTCCCCATTGTGTG TGG (reversed) Intronic
902415055 1:16233575-16233597 TATCCTTTGCCCATCCTGGGAGG - Intronic
905965476 1:42090987-42091009 TATCCTTTCCTTCTTTTGTGGGG - Intergenic
906011704 1:42533092-42533114 TGCCCTTTCCCCACTGGGTGGGG + Intronic
906850074 1:49238683-49238705 TTTATTTTCCCCATTGTGTTTGG + Intronic
907367369 1:53973564-53973586 TACCCATTACCCATTGTGTTTGG + Intergenic
907418892 1:54333206-54333228 AATCCTTTCCGTATTCTGTGGGG - Intronic
907606004 1:55818138-55818160 TTACCTATCCCCATTGTGTGGGG + Intergenic
907847364 1:58221328-58221350 AATCTTTTCCCCATTGTTTAGGG - Intronic
908065122 1:60394637-60394659 TTTCGTTTCCCCATTTTCTGTGG - Intergenic
909926111 1:81439752-81439774 GTCCCTTGCCCCATTGTGTGAGG + Intronic
912164603 1:107028358-107028380 TACCCTTTCCCCATTGGCTCGGG - Intergenic
912317799 1:108681990-108682012 TACCCTTTCCCCATTGGCCGGGG - Intergenic
915135834 1:153730844-153730866 TATTTTTTTCCCAATGTGTGTGG + Intronic
915833622 1:159155068-159155090 TATCCTTTGCCCACTTTTTGAGG + Intergenic
916158495 1:161883209-161883231 TACCCTTTTTCCATTTTGTGGGG + Intronic
916634202 1:166650721-166650743 AATCTCTTCTCCATTGTGTGTGG - Intergenic
917060065 1:171027872-171027894 TATCCTTTGCCCACTTTTTGAGG + Intronic
917269476 1:173257695-173257717 TATCCTTTCCCCATGGAATTAGG + Intergenic
917753765 1:178078816-178078838 TATCCATTCCACATTGTTTCTGG + Intergenic
917890756 1:179436012-179436034 TATCCTTTGCCCACTTTTTGAGG - Intronic
918710837 1:187727843-187727865 CATCCTTTCCCCACTAAGTGGGG - Intergenic
920967200 1:210711166-210711188 TCTCCTTCCCCCATGGTCTGGGG - Intronic
921140982 1:212306093-212306115 TACCCTTTCCCCATTGGCCGGGG + Intronic
922410204 1:225366040-225366062 TGTCCTTTGCCCATTTTGTATGG - Intronic
923936397 1:238765118-238765140 TATCTTTCCCCCATTGGCTGGGG + Intergenic
1063034285 10:2270079-2270101 TATCATTTCTCCATAGTATGAGG - Intergenic
1065473192 10:26104445-26104467 TATCCTTTCCCCATTGTTCTTGG + Intronic
1066689020 10:38008339-38008361 TGTCCCTTCCCCATTGGCTGGGG - Intergenic
1067399353 10:45956756-45956778 TACCCTTTCCCCATTGGCTGGGG + Intergenic
1067867671 10:49925972-49925994 TACCCTTTCCCCATTGGCTGGGG + Intronic
1068536898 10:58249941-58249963 CATCCCTTCCCCAATGTATGTGG + Intronic
1069834203 10:71298327-71298349 TGCTCTTTTCCCATTGTGTGGGG + Intronic
1072141287 10:92591381-92591403 TATCTTTTTCCCATTGGCTGGGG - Intergenic
1072173549 10:92892075-92892097 CATCCGTTGCCCATTGTTTGAGG - Intronic
1073501610 10:103943410-103943432 TATCCTTTGCCCATGGTGGATGG + Intergenic
1073885952 10:108039890-108039912 TGTCTTTTCCCCATTGACTGGGG + Intergenic
1075841605 10:125509355-125509377 TTTCCCTTCCCCATTGTGAATGG - Intergenic
1077180902 11:1215239-1215261 TATCCTTTTCCCATTGTTCATGG - Intergenic
1077770416 11:5212193-5212215 TGTCCTTTACCCATTTTTTGTGG + Intergenic
1078776248 11:14396442-14396464 TTGCCTTTCCCCAGTGTGGGTGG + Intergenic
1079656534 11:22992847-22992869 TGTCCTTTCCCCATTGGTTGGGG + Intergenic
1081142626 11:39521297-39521319 TATCCTTTGCCCACTTTTTGAGG - Intergenic
1082111760 11:48284548-48284570 TATCCTTTGCCCACTTTTTGAGG + Intergenic
1083383242 11:62285978-62286000 TACCCTTTCCCCATTGGCTGGGG - Intergenic
1084452492 11:69248071-69248093 GCTCCTTTCCCCATAGAGTGGGG - Intergenic
1084755342 11:71234943-71234965 TTTCGTGTCTCCATTGTGTGTGG - Intronic
1084797276 11:71516359-71516381 TATCCTTTGCCCACTTTTTGAGG - Intronic
1086586493 11:88458672-88458694 TATCCTTTACCCACTTTTTGAGG + Intergenic
1086646625 11:89230264-89230286 TGTCCTTTCCCCATTGTTTTTGG - Intronic
1087614370 11:100471339-100471361 TATCCCTACCCCATGGTGTGTGG + Intergenic
1087670982 11:101106388-101106410 TATCCTTTGCCCAATTTATGAGG - Intronic
1087820849 11:102710360-102710382 TTTCCATTCCCCATTGGATGAGG - Intergenic
1088072452 11:105806232-105806254 TCTCCTATTCCCATTATGTGGGG - Intronic
1089551480 11:119282463-119282485 AATCCTTTCCCCATTCTGGAAGG - Intronic
1091994347 12:4981543-4981565 TATTCTTTCCCCATGGAGTCAGG + Intergenic
1093561622 12:20548737-20548759 TTTCTTTTCCTCATTGTCTGTGG + Intronic
1093706454 12:22279789-22279811 ACCCCTTTCCCCATTGTGTTGGG + Intronic
1093854957 12:24090778-24090800 TATCATTTCCCCATTATCTCAGG - Intergenic
1094117436 12:26932349-26932371 TTGCCTTTCCCCACTGTGTTTGG - Intronic
1094616912 12:32044222-32044244 TGTCCTTTCCCCATTGGCTGGGG + Intergenic
1095234818 12:39783689-39783711 TATCCTTTGCCCACTTTTTGGGG + Intronic
1095408890 12:41900449-41900471 TATCCCTTTCCCATTGTGTGTGG - Intergenic
1096569871 12:52516063-52516085 TATACTTTCCCCATAGTGGGTGG - Intronic
1096918769 12:55061394-55061416 CATTCTTTCCTCATTGTGTTTGG - Intergenic
1097758364 12:63432194-63432216 TATCCTTTGTCCATTTTCTGTGG - Intergenic
1097901737 12:64880498-64880520 CTCCCTTTCTCCATTGTGTGAGG - Intronic
1100651908 12:96599827-96599849 TATCCTTTGCCCACTTTTTGGGG + Intronic
1101270331 12:103136765-103136787 TGTCCTTTCCCCAATGTATGAGG - Intergenic
1101810000 12:108099442-108099464 TATTCTTTGCCCATTTTCTGTGG + Intergenic
1104488646 12:129174897-129174919 TGTCCTTTGCCCATTTTTTGAGG + Intronic
1106362691 13:29046953-29046975 TACCCTTTCCCCATTGGCTGGGG - Intronic
1106883143 13:34153564-34153586 TAACCTTTCCCCATTGGCCGGGG + Intergenic
1108040266 13:46333349-46333371 TCTCCTGCCCCCATGGTGTGAGG + Intergenic
1108187254 13:47900518-47900540 TATCCTTTGCCCACTTTTTGAGG - Intergenic
1108206076 13:48091997-48092019 TTTCCTCTCCCCATTGTGCCAGG - Intronic
1108425505 13:50295122-50295144 TATCCTTTGCCCATTTTTTATGG + Intronic
1109704706 13:66074436-66074458 TCTCCTTTCCCCATTGCCAGAGG - Intergenic
1110684247 13:78352753-78352775 TAGCCTTTCCAAAATGTGTGTGG + Intergenic
1111476061 13:88749444-88749466 TTTCCTTTCACCAGTGTGTCAGG + Intergenic
1111619844 13:90710417-90710439 TATCCTTCCCCCAGTGAGTTAGG - Intergenic
1111624823 13:90771596-90771618 TTTCCTTTCACAATTGTGTTAGG + Intergenic
1114227465 14:20752247-20752269 TGTCCTTTCTCCATTGGCTGGGG - Intergenic
1114638893 14:24205915-24205937 TCTCCCTTCCCCATGGTGTTGGG - Exonic
1114842848 14:26286198-26286220 AATACTTTCCCCAGTGTATGTGG - Intergenic
1115019048 14:28652733-28652755 TGACCTTTCCCCATTTTGTAAGG + Intergenic
1116314456 14:43370040-43370062 TGTCCTTTGCCCATTTTGAGTGG - Intergenic
1116567088 14:46461606-46461628 TGTCCTTTCCCCAATGTTTTTGG - Intergenic
1117240333 14:53825696-53825718 TATCCTTTCTCCCTTCAGTGAGG - Intergenic
1117283286 14:54261427-54261449 TACCCTTTCCCCATTGGCCGGGG + Intergenic
1118017144 14:61672039-61672061 TACCCTTTCCCCATTGGCCGGGG + Intergenic
1121238203 14:92408851-92408873 TATCCTTTCCTCAGTGGTTGTGG + Intronic
1121877513 14:97467046-97467068 TATCCTTTTCCCATTGGCTTGGG + Intergenic
1124695052 15:31857483-31857505 TTTCCTTTCCCGAGTGTGTAAGG - Intronic
1125405280 15:39346633-39346655 TACCCTTTCCCTTTTGTGTTTGG - Intergenic
1130697478 15:86145096-86145118 TATCATTTCCTCTTTGTGTAAGG + Intronic
1130917905 15:88320341-88320363 TATTCTTTCCCCATTTTCTTTGG + Intergenic
1131454052 15:92569592-92569614 CACCCTTTCCCCATTATGTGAGG + Intergenic
1131712186 15:95068011-95068033 TGTGCCTTCCCCATTCTGTGAGG + Intergenic
1132107092 15:99070957-99070979 AGACCTCTCCCCATTGTGTGAGG + Intergenic
1132169086 15:99629414-99629436 TACCTTTTTCCCATTGTCTGGGG + Intronic
1133682109 16:8129398-8129420 TGACCTTTCCCCATTGGCTGGGG + Intergenic
1133962268 16:10504871-10504893 TGTCCTTTCCCCATTGGCTGAGG - Intergenic
1136351288 16:29709848-29709870 TACCCTTTCCTCATTGGCTGGGG + Intergenic
1136414927 16:30097010-30097032 TGTCCTTTCCCCATTGGCTGGGG - Intergenic
1136415956 16:30103977-30103999 TGTCCTTTCCCCATTGACTGGGG - Intergenic
1137355985 16:47764607-47764629 TATCCTTTAGCCATTCTTTGAGG - Intergenic
1141028168 16:80567261-80567283 AATCCTCTCCCCATTCTGTGAGG + Intergenic
1141439887 16:84023282-84023304 TACCCTTTTCCCATTGGCTGGGG - Intronic
1142553547 17:756172-756194 TACCCTTTCCCCATTGGCCGGGG + Intergenic
1143120254 17:4602173-4602195 TTTCCTTTCAGCATTGTGTCTGG - Intronic
1143715901 17:8768787-8768809 TACCCTTTCCCCATTGGCTGGGG - Intergenic
1146680066 17:34800690-34800712 ACTCCTGTCCCCATTGTTTGAGG + Intergenic
1147521594 17:41178384-41178406 TCTCCTTTCCCTAATGTGTTAGG + Intergenic
1147523121 17:41193764-41193786 TATCCTTTGCCCACTTTTTGAGG - Intronic
1148273764 17:46284567-46284589 TTTCTTTTCCCCACAGTGTGGGG + Intronic
1149784516 17:59423802-59423824 TGTCCTTTCTCCACAGTGTGAGG - Intergenic
1150409294 17:64930014-64930036 TTTCTTTTCCCCACAGTGTGGGG - Intergenic
1151071649 17:71220315-71220337 CATCCTTTTCCCTTTGTTTGTGG - Intergenic
1155105694 18:22663666-22663688 TGTCCTTTCCCCATTTTTTGAGG - Intergenic
1155365034 18:25041396-25041418 TACCTTTTCCCCATGGTGTGCGG + Intergenic
1156692515 18:39725457-39725479 TTTCTTCTCCCCATTGTGGGTGG - Intergenic
1156933601 18:42675641-42675663 GATCCTTCCCCTAGTGTGTGTGG + Intergenic
1157087304 18:44594225-44594247 CCTCCTTTCCCCATTGTTTATGG - Intergenic
1157951483 18:52043334-52043356 TAGCCTTGCTCCATTGGGTGAGG - Intergenic
1159556619 18:69952488-69952510 TATTCTTTCCCCACTCAGTGGGG - Intronic
1162221196 19:9178161-9178183 TGTCCTTTCCCCATTGGCTGGGG + Intergenic
1162823235 19:13235986-13236008 TTTCTTTTCCCCATTGTGGGTGG - Intronic
1164959624 19:32416689-32416711 TATCTTTTCCCCATGGAGTCAGG + Intronic
1165660967 19:37579476-37579498 AATCCTTTCCCCATTGGTTAAGG - Intronic
1166655425 19:44607730-44607752 TACCCTTTCCCCATTGGCTGGGG - Intergenic
1168224702 19:54986256-54986278 TATGTTTCCCGCATTGTGTGAGG + Exonic
1168378573 19:55901304-55901326 TGCCCTTTCCCCATTGGCTGGGG + Intronic
925516118 2:4683764-4683786 TATTCTTTCCGGATTCTGTGAGG - Intergenic
926273836 2:11388604-11388626 TATACCTTCCCCATTGGATGTGG - Intergenic
926681640 2:15668602-15668624 TATGCTTTTGTCATTGTGTGGGG - Intergenic
927870687 2:26621161-26621183 AGTCCTTTCCCCTGTGTGTGAGG - Intronic
930286514 2:49436025-49436047 TATCCTTTGCCCATTTTTGGTGG - Intergenic
931521390 2:63101042-63101064 GATCCTTTGCCCATTGTTTCAGG + Intergenic
932373572 2:71213854-71213876 TGTCCTTTCCCCCTTGTATTTGG - Intronic
932477222 2:72013794-72013816 TCTCCTCTCCCCCTTGTGTGGGG - Intergenic
933399953 2:81783377-81783399 TATTGTTTCCTCATTGTCTGGGG + Intergenic
934226509 2:90136715-90136737 TATCCTTTGCCCAATTTTTGAGG - Intergenic
935281951 2:101526028-101526050 TACCCTCTCCCCATTGGCTGGGG + Intergenic
935858405 2:107300147-107300169 TATCATTTCCCAAATGTATGTGG - Intergenic
936897808 2:117447570-117447592 TATCCTTTGCCCACTGTTTTAGG - Intergenic
937912660 2:127082977-127082999 TATCCTTTCCACTTTCTTTGAGG - Intronic
938628440 2:133137926-133137948 TACCCTTTCCCCATTGGCTGAGG + Intronic
940096554 2:149982850-149982872 TATCCTTTGCCTATTTTTTGAGG - Intergenic
941009404 2:160282363-160282385 TAGCCTTTCCCCATTGGGGTTGG + Intronic
941011756 2:160308118-160308140 AATCATTTCCCCACTGGGTGTGG + Intronic
941161870 2:162044743-162044765 TAACCTTTCCTGAATGTGTGAGG + Intronic
941267346 2:163378972-163378994 TATCCTTTGCCCACTTTTTGAGG + Intergenic
941580295 2:167289017-167289039 TATCCTTTCCCCATTCTGCGTGG + Intergenic
943276597 2:185875940-185875962 TATCCTTACCCCATTGTGCCAGG + Intergenic
946166023 2:217864245-217864267 TACCCTCTCCCCATTCAGTGAGG - Intronic
948925490 2:241094161-241094183 TCCCTTTTCCCCATTGCGTGTGG + Exonic
1169301232 20:4443578-4443600 TATTCTTTCCCCAGTGTGGAGGG + Intergenic
1171478033 20:25428729-25428751 TGCCCTTTCCCCATTGTGAATGG + Intronic
1173351779 20:42252199-42252221 TATTCTTTTTCCATTGTGTCTGG - Intronic
1173720632 20:45254591-45254613 TATTCTTTCACCAGTGGGTGTGG + Intergenic
1174138356 20:48395938-48395960 TACCCTTTCCCCATTGGCTGGGG - Intergenic
1174482152 20:50838890-50838912 TCTCCTTTCTCCATGGGGTGTGG - Intronic
1174493935 20:50925552-50925574 CATGCTTTGCCCATTGTGGGTGG - Intronic
1174946085 20:54987345-54987367 TATCCTTTCATCAGTATGTGGGG + Intergenic
1177267584 21:18804474-18804496 TACCCTTTCCCCATTGGCTGGGG - Intergenic
1179008750 21:37536946-37536968 TGTCCTTCCCCCATTGGCTGGGG + Intergenic
1179649182 21:42795663-42795685 TACCCTTTCCCCATTGGCTGGGG - Intergenic
1180233750 21:46443930-46443952 TGACCTTCCCCCACTGTGTGGGG - Exonic
1181967239 22:26665768-26665790 GAGCCTGTCCCCATTTTGTGGGG + Intergenic
1182819527 22:33203380-33203402 TAGCCTTTCCCCTTGGTGGGTGG + Intronic
1182973842 22:34603736-34603758 CATCCCTTCCCCATTTTGAGTGG - Intergenic
949243951 3:1903381-1903403 TGTCCTTTTCCCTTTTTGTGGGG - Intergenic
949967085 3:9365939-9365961 TTTCCTTTCAGCATTGTGTTGGG + Intronic
950228393 3:11254902-11254924 TGTCCTTTCCGCATTGGCTGGGG + Intronic
951936048 3:28024453-28024475 TACACTTTCCCCATTGTCTTGGG - Intergenic
952240194 3:31524234-31524256 TATCCTTTCAACATTCTCTGTGG - Intergenic
952683539 3:36123171-36123193 TATCCTTTGCACATTTTTTGAGG - Intergenic
953974909 3:47375201-47375223 TATCCCCACCCCATTCTGTGGGG + Intergenic
954067188 3:48116189-48116211 TACCCTTTCCCCATTGGCCGGGG - Intergenic
954655688 3:52192797-52192819 GATCCTCTACCCACTGTGTGCGG + Intergenic
955089897 3:55739579-55739601 TATCCTTTGCCCACTTTTTGTGG + Intronic
956442416 3:69293401-69293423 TCTCATTTCTCCAGTGTGTGAGG - Intronic
957013764 3:75038962-75038984 TATCCTCTGTCCATTTTGTGAGG + Intergenic
960125174 3:113990739-113990761 TATACTTCCCCCATTTTATGAGG + Intronic
960891005 3:122447933-122447955 TATCCTTTGCCCACTTTTTGAGG - Intronic
961010724 3:123434007-123434029 CCTCCTTTCCCCATGGTGTCTGG - Intronic
962078034 3:132105101-132105123 AATGCTTTCCCCTTTATGTGGGG - Intronic
962644108 3:137419207-137419229 TAGCATTTCCACATTGTGTGCGG - Intergenic
962777076 3:138671823-138671845 CATTCTTTCCCCATTGGCTGGGG + Intronic
963505854 3:146183626-146183648 AATCCTTTCCCCATTTCTTGTGG - Intergenic
965969245 3:174533159-174533181 TACCCCTTCCCCATTGGCTGGGG - Intronic
966143890 3:176788023-176788045 TATCATTTCCCCATTCTCTCTGG - Intergenic
969279330 4:6159114-6159136 TATTTTTTCACCATTATGTGTGG - Intronic
969916794 4:10499221-10499243 TCCCCTTTCCCCATTGGCTGGGG - Intronic
970236458 4:13963689-13963711 TACCCTTTCCTCATTGTTTCTGG + Intergenic
971026157 4:22589843-22589865 TGTCCTTTCCTCATTGGGTAAGG - Intergenic
973097650 4:46223029-46223051 TTTCCTTTCACCAATGTGGGTGG + Intergenic
973761255 4:54117702-54117724 TGTCCTTTCCCTATTGAGTATGG + Intronic
974100204 4:57407770-57407792 TTTCCATTCCCTACTGTGTGGGG + Intergenic
974925968 4:68297806-68297828 TGTCCTTTGCCCATTTTGTAAGG + Intergenic
976079897 4:81344466-81344488 TATCCTTTTCCCACTTTTTGAGG - Intergenic
976267358 4:83196639-83196661 TATTCTTTTCCTATTTTGTGTGG - Intergenic
977032231 4:91899507-91899529 TATTCTTTCACCATTATATGTGG - Intergenic
977406958 4:96611714-96611736 TATCCTTTTGCCATACTGTGTGG - Intergenic
978311447 4:107388369-107388391 TACCCTTTCCCCATTGGCTGTGG - Intergenic
978469137 4:109042917-109042939 TATCCTATCCTCATCGTGTATGG - Intronic
980104860 4:128577920-128577942 TCCCCTTTCCCCATTCTTTGGGG + Intergenic
980859647 4:138483976-138483998 TATCCTTTGCCTATTTTGTGAGG + Intergenic
981083045 4:140654217-140654239 TACCCTTTCCCCATTGTCTGGGG + Intronic
982234919 4:153243242-153243264 TATCACTTTCCAATTGTGTGGGG - Intronic
983709277 4:170694180-170694202 TACCCTTTCCCCATTGGCCGGGG + Intergenic
984328856 4:178289847-178289869 TATCCTTTGCCCACTTTTTGAGG - Intergenic
985135810 4:186784966-186784988 TTACCTTTCCCTTTTGTGTGTGG + Intergenic
985468411 5:20308-20330 CATGCTTTCCCCACTCTGTGCGG + Intergenic
987515795 5:18906336-18906358 AATCCTTCCCCCATTTTGGGTGG + Intergenic
988703289 5:33697799-33697821 TACCCTTTCCCCATTGGCCGGGG - Intronic
990848955 5:60179156-60179178 TATCCCTACCCCCATGTGTGTGG + Intronic
991119482 5:62994465-62994487 GACATTTTCCCCATTGTGTGGGG + Intergenic
991195721 5:63929992-63930014 TACCCTTTCCCCATTGGCTGGGG + Intergenic
993153186 5:84187130-84187152 TATGCTGTCCCCATTGTGTTAGG - Intronic
993375013 5:87140550-87140572 TTTCCTTTCCCCATTTCCTGCGG - Intergenic
993742737 5:91560693-91560715 TAACCTTTCCCCACTTTTTGAGG - Intergenic
994495500 5:100507215-100507237 TATCCTTTGCCCATTTTTTATGG - Intergenic
995857136 5:116605355-116605377 TATGATTTTCCCATTCTGTGGGG + Intergenic
995911948 5:117198346-117198368 TATCCTTTGCCCACTTTTTGAGG - Intergenic
998261902 5:140638193-140638215 TACCCTTTCCCCATTGGCCGGGG + Intergenic
1000494547 5:161964807-161964829 CATCTTTTGCCCATTGTGTGTGG - Intergenic
1000606320 5:163331306-163331328 TACCCTTTCCCCATTGGCCGGGG + Intergenic
1000675866 5:164121844-164121866 TATCCTTTGCCCAGTTTTTGAGG + Intergenic
1001551676 5:172607122-172607144 TTTTCTTTCCCCATTAAGTGGGG - Intergenic
1002308032 5:178295515-178295537 TATCCTCTCACCAGTGTGTGAGG - Intronic
1002649713 5:180682338-180682360 ATCCCTCTCCCCATTGTGTGCGG - Intergenic
1003927984 6:10895378-10895400 TACCCTTTCCCCATTGGCCGGGG + Intronic
1004213742 6:13681433-13681455 TTCCCTTTCCCCAGTGTCTGTGG - Intronic
1004293227 6:14387320-14387342 TACCCTTTCCCCATTGGCCGGGG + Intergenic
1004705927 6:18123651-18123673 TATGCCTGCCCCATTGTGTTAGG + Intergenic
1005267994 6:24133290-24133312 TATATTTTACCCATTGTTTGTGG - Intronic
1007096976 6:39219281-39219303 TATCCTCTCCCCTTTGAGGGAGG - Intronic
1008078745 6:47172860-47172882 TATCCTTTGCCCACTTTTTGTGG - Intergenic
1008893469 6:56523798-56523820 TGTCCTTACCCCATCATGTGTGG + Intronic
1008933090 6:56960104-56960126 TATAGTTTCCACATTGAGTGTGG + Intronic
1009378344 6:62999301-62999323 TACACTTTCCCCATTGGCTGGGG + Intergenic
1010284199 6:74055986-74056008 AATCTTTTCCCCTTTGTGTTTGG + Intergenic
1012250861 6:96979074-96979096 AATATTTTCCCCATTTTGTGGGG + Intronic
1014079018 6:117267396-117267418 TATCATTTCCTCAATGTGTGTGG + Intronic
1014197719 6:118578391-118578413 TGTCCTTTCCCCATTGGCTAGGG - Intronic
1014308681 6:119771660-119771682 TGCCCTTTCCCCATTGGCTGGGG + Intergenic
1014892711 6:126862338-126862360 TATCCTTTGCCCACTTTTTGAGG + Intergenic
1016774191 6:147886503-147886525 AATCCTCTCCCCCTTGAGTGTGG + Intergenic
1018191787 6:161315304-161315326 TATCCTTTCCCTATTGGCTAGGG + Intergenic
1019048963 6:169168878-169168900 TATGCTTTCTCCATAGCGTGAGG + Intergenic
1019899439 7:4008477-4008499 TACCCTTTCCCCATTGGCCGGGG + Intronic
1020431436 7:8120169-8120191 TTCCCTTTCCCCGTAGTGTGAGG + Intronic
1020637585 7:10715093-10715115 TATCCTTTGGCCATATTGTGAGG - Intergenic
1020669017 7:11083126-11083148 TGCCCTTTCCCCATTGGCTGGGG - Intronic
1022186177 7:27971657-27971679 TATCGTTTTCCCCTTATGTGCGG - Intronic
1022260881 7:28703749-28703771 TATACCTTCCCCAATGTGGGTGG - Intronic
1023072128 7:36446357-36446379 TGTTCTTTCCCCACTGTGTTAGG + Intronic
1023593925 7:41809110-41809132 TAGCTTTTCCCAACTGTGTGAGG - Intergenic
1024177048 7:46851282-46851304 TATGCTTTCCCCATTGTACTTGG + Intergenic
1024813214 7:53237597-53237619 TGCCCTTTCCCCATTGGCTGGGG + Intergenic
1027562390 7:79748260-79748282 GTTCCTTTCCACATTGTGGGAGG + Intergenic
1027641167 7:80735438-80735460 TACCCTTTCCCCATTGGCCGGGG + Intergenic
1027988078 7:85320729-85320751 GAACCTTTACCAATTGTGTGTGG - Intergenic
1029633690 7:101769553-101769575 TATTCCCTCACCATTGTGTGCGG + Intergenic
1032261477 7:130340862-130340884 TATCCTGTCCCTATGGTGTATGG + Intergenic
1032668918 7:134065835-134065857 TATCCATTTGCCCTTGTGTGTGG - Intronic
1035147010 7:156829087-156829109 TATGCTTTCCCCGTTGGCTGGGG - Intronic
1035702341 8:1646151-1646173 GATGCTTTCCCCAGTGTGGGTGG + Intronic
1035777699 8:2202147-2202169 TATCATTTCCCCCTTGTGAATGG + Intergenic
1035874219 8:3170014-3170036 TGTCCTTTCCCCATTGGCTGGGG - Intronic
1035933184 8:3807082-3807104 TAACCTTCCCCCAGTGCGTGGGG - Intronic
1036765463 8:11547027-11547049 CATCCCTTCCCCATGCTGTGTGG - Intronic
1036783578 8:11669863-11669885 TATCCTTTTCCCCATGTGTTTGG + Intergenic
1037090937 8:14917687-14917709 TTTCCTTGCCCCATTATGAGTGG - Intronic
1039014351 8:33129471-33129493 TACCCTTTCCCCATTGGCCGGGG + Intergenic
1039034388 8:33343990-33344012 AATCATTACCCCATTGTGTTAGG + Intergenic
1039450381 8:37669338-37669360 TCTCCCTTCCCCAATCTGTGTGG + Intergenic
1040085733 8:43338808-43338830 TATCCTTTGCCCACTTTTTGAGG - Intergenic
1040771835 8:50987301-50987323 TATCCTTTGCCCACTTTTTGAGG + Intergenic
1041273333 8:56131400-56131422 TATCTATTCCCAGTTGTGTGAGG - Intergenic
1041279907 8:56198856-56198878 TGTCCTTTGCTCATTGTGGGTGG + Intronic
1043707805 8:83375453-83375475 TATCCTTACCTCATTATTTGTGG - Intergenic
1043833316 8:85016264-85016286 CATCCCTTCCCCATTTTCTGGGG + Intergenic
1044562692 8:93628395-93628417 TATTCTTACCCAATTCTGTGAGG + Intergenic
1044869840 8:96607859-96607881 TTTCCTGTCCCCACTCTGTGGGG - Intronic
1046224406 8:111259379-111259401 TGTCCTTTTCCCATTGGCTGGGG + Intergenic
1046569735 8:115948167-115948189 TTTCCTTTCCTTTTTGTGTGTGG - Intergenic
1047380071 8:124353169-124353191 AATCCCTTCCCCTTAGTGTGTGG - Intronic
1048417305 8:134241875-134241897 GGTCCTTTACCCATTGTGTCTGG + Intergenic
1048653213 8:136504464-136504486 TATCCTTTTCCCTCTGTGAGTGG + Intergenic
1050479927 9:6079020-6079042 TACCCTTTCCCCATTGGCCGGGG - Intergenic
1050481127 9:6087663-6087685 TACCCTTTCCCCATTGGTCGGGG - Intergenic
1052303269 9:26976448-26976470 TGCCCTTTCCCCATTGGCTGGGG + Intronic
1053027762 9:34744727-34744749 TATCATTTCCCAAATGTGTCAGG + Intergenic
1053097148 9:35338510-35338532 TATGCTTTCTCCATGGTGTAGGG + Intronic
1053353758 9:37430080-37430102 TTACCATTCCCCATTGTGGGCGG + Intronic
1053477719 9:38394058-38394080 TACCCTTTCCCCATTGGCTGGGG - Intronic
1054748837 9:68883886-68883908 TATCCTTTCCCCATTGTGTGTGG - Intronic
1055002012 9:71461942-71461964 TAACCTTTCCCCAAAGAGTGAGG - Intergenic
1055330507 9:75178316-75178338 TACCCTTTCCCCATTGGCTGGGG + Intergenic
1055701800 9:78952528-78952550 TATCATGTCCCCACTATGTGTGG - Intergenic
1056462378 9:86820473-86820495 TCTCCCTCCCACATTGTGTGTGG + Intergenic
1057866787 9:98687737-98687759 TAAGCTTTCTACATTGTGTGTGG - Intronic
1057994870 9:99812288-99812310 TATCCTTTGCCTATTTTGGGAGG - Intergenic
1058307450 9:103461016-103461038 TACCCTTTCCCCATTGGCCGAGG - Intergenic
1058558570 9:106199168-106199190 TATCCTTTGCCCATTTTTTATGG + Intergenic
1058821409 9:108733584-108733606 AATCGTTTCCCCATTGCTTGTGG - Intergenic
1059470340 9:114500374-114500396 TGTCCTTTTCCCATTGTGCATGG - Intronic
1059934510 9:119295773-119295795 AACCTTTTCCTCATTGTGTGTGG - Intronic
1061640179 9:131947779-131947801 TATATTTTACACATTGTGTGGGG - Intronic
1061722625 9:132562179-132562201 TATCCTTTCTAAACTGTGTGTGG + Intronic
1062178451 9:135177261-135177283 TTTCTTTTCCCCACTGGGTGTGG + Intergenic
1186156282 X:6729909-6729931 TATCCTTTTCCCATTGGCTGGGG - Intergenic
1188763548 X:34061326-34061348 TAACTTATCCCCATTGTTTGTGG + Intergenic
1189372357 X:40438928-40438950 TACCCTTTCCCCATTGGCTTGGG + Intergenic
1190399294 X:50015473-50015495 TCTCATTTCCATATTGTGTGGGG - Intronic
1191066142 X:56349781-56349803 TATCCTTTGCCCACTTTTTGAGG + Intergenic
1191180036 X:57552569-57552591 TGTCCTTTCCCTATTGGCTGGGG - Intergenic
1191227284 X:58056591-58056613 TATCTTCACCCCATTGTTTGTGG - Intergenic
1191985710 X:66978336-66978358 TATCCTTTACCCAATTTTTGAGG - Intergenic
1192118265 X:68432071-68432093 TCTCCTTCCCCCATTGTGTGTGG - Intronic
1192339102 X:70247726-70247748 TATCTTTTGCCTATTTTGTGGGG + Intergenic
1192681354 X:73257124-73257146 TACCCTTTCCCCATTGGCCGGGG + Intergenic
1193879388 X:86902509-86902531 TATCCTTTACCCACTGTATTAGG - Intergenic
1194074538 X:89372228-89372250 TATCCTTTGCCCACTTTTTGAGG - Intergenic
1195010332 X:100727476-100727498 TACCCTTTCACCATTGCGAGTGG - Intronic
1195263142 X:103153692-103153714 TCTCCTGTCCCCAGTGAGTGTGG + Intergenic
1197382439 X:125761831-125761853 TATCCTTTGCCCATTTTGATGGG - Intergenic
1197522062 X:127511013-127511035 TATCCTTTGCCCATTCAGAGAGG - Intergenic
1198562229 X:137863373-137863395 TATCCTATCAGCATTGAGTGTGG - Intergenic
1198709354 X:139484466-139484488 TTGATTTTCCCCATTGTGTGTGG + Intergenic
1198864323 X:141105289-141105311 CACCCTTTCCCCATTGGCTGGGG - Intergenic
1198898366 X:141482127-141482149 TACCCTTTCCCCATTGGCTGGGG + Intergenic
1199384251 X:147205601-147205623 TATCCTTTGCCCACTTTTTGGGG - Intergenic
1199389354 X:147261932-147261954 GATACTTTCCCCATTGTCTTGGG - Intergenic
1199426599 X:147708975-147708997 TGTATTTTCTCCATTGTGTGTGG - Intergenic
1199828918 X:151529358-151529380 TATCCCTTCCCCCTTAAGTGTGG - Intergenic
1200729933 Y:6723754-6723776 TATCCTTTGCCCACTTTTTGAGG - Intergenic
1200788510 Y:7279519-7279541 TGTCCTTTCCCCATTGGCTGGGG + Intergenic
1201566800 Y:15373764-15373786 TATCCTTTGCCCATTTTTTGAGG - Intergenic
1201597400 Y:15686414-15686436 TATCCTTTGCCCACTTTTTGAGG - Intergenic
1201912138 Y:19143592-19143614 TGTCCTTTCCCCAGTGGCTGGGG - Intergenic
1201923705 Y:19261932-19261954 TATCCCTTCTCCACTTTGTGGGG + Intergenic
1201973159 Y:19817649-19817671 TACCCTTTCCCGATTGGCTGGGG + Intergenic