ID: 1054754730

View in Genome Browser
Species Human (GRCh38)
Location 9:68946298-68946320
Sequence GGGGCTGTGTAGCCCTAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054754730 Original CRISPR GGGGCTGTGTAGCCCTAGAC TGG (reversed) Intronic
904337386 1:29806946-29806968 GGGGCAGTGTGGCCTTGGACTGG + Intergenic
904839715 1:33364518-33364540 GGAACTGTATAGCCCAAGACAGG + Intronic
905798210 1:40827314-40827336 GGGGCTGTGGAGCCCGGGTCAGG + Intronic
907318166 1:53585810-53585832 GGGGCACTGTTGCCCTAGTCAGG - Intronic
907937655 1:59057226-59057248 GGGGCTGGGCAGGCCTAGAGGGG + Intergenic
911419258 1:97618642-97618664 CTGGTTGTGTAGCCATAGACTGG - Intronic
914718160 1:150268422-150268444 GGGGCTGTGCTGACCTAGGCAGG - Exonic
915343434 1:155188533-155188555 GGGGCGGTGGAGCCCAAGGCGGG + Intronic
915355048 1:155250837-155250859 GGCGCTGTGTAGCACCAGCCTGG + Intronic
919487703 1:198164308-198164330 GTGGCTGTATGGCCCTAGACCGG - Intronic
1062837038 10:642370-642392 AGGGCGATGTGGCCCTAGACTGG - Intronic
1067338054 10:45380021-45380043 GGGGCTGAGTGGCCCAGGACTGG - Intronic
1074445599 10:113518918-113518940 GTGGCTGTGTGGCCTTAGGCAGG - Intergenic
1075805817 10:125188056-125188078 GAGGCTGGGAAGCCCCAGACAGG - Intergenic
1077033097 11:479030-479052 GGGGCCGTGGAGGCCTGGACCGG + Intronic
1077211599 11:1373490-1373512 GGGGCTGTGTGGCCCTGTTCTGG + Intergenic
1082792621 11:57357391-57357413 GGAGCTGTGTGGCCTTGGACAGG - Intronic
1083234975 11:61345476-61345498 GGGGCTGTGCAGCCGCAGTCAGG - Exonic
1083310672 11:61782086-61782108 GGGGCTGTATAACCCTGGGCAGG - Intronic
1083335741 11:61920568-61920590 CTGGCTGTGTAGCCCTAGACAGG + Intergenic
1083487099 11:62990126-62990148 GGGGCAGTGTAGCACAAGGCTGG + Intronic
1089619990 11:119716676-119716698 GGGGCAGTGTAGACCTTGCCCGG + Intronic
1092121052 12:6044204-6044226 GGGGCTGTGCAGCCAGAGAGAGG - Intronic
1092158441 12:6300807-6300829 TGGGCTGTGTGGTCTTAGACAGG - Intergenic
1095627960 12:44340526-44340548 GGGCCTCTGTAGCTCGAGACTGG - Intronic
1100614576 12:96221133-96221155 GTGACTGTGTAGCCCTGCACTGG - Intronic
1103723975 12:122988899-122988921 GGGGCTGTATAGCCCCAGACAGG + Intronic
1103763685 12:123267932-123267954 AGGGCTCTGTATCCCAAGACAGG + Intronic
1103852141 12:123940244-123940266 GGGGCTGTGTGGCCTTGGGCAGG - Intronic
1106173576 13:27309306-27309328 GTGGGTGTGGAGCCCTAGCCAGG + Intergenic
1106319387 13:28624039-28624061 AGGTCTGTGGAGCCCTAGCCAGG - Intergenic
1113949787 13:114065609-114065631 AGGGCTGTGTGGCCCTGCACTGG - Intronic
1118907229 14:70031811-70031833 GAGGTTGGGTAGCCCTGGACTGG + Intronic
1122412927 14:101535122-101535144 GTGGCTGGGCAGCCCTAGCCAGG - Intergenic
1122546322 14:102524656-102524678 GGCGCTGTGAAGCCTGAGACTGG + Intergenic
1123997481 15:25728988-25729010 GGGCCTGTGTCGCCCTCGGCCGG - Intronic
1124603180 15:31151476-31151498 GGAGCTGTGTGGCCCTGGGCAGG - Intronic
1129490462 15:75920386-75920408 TGGGCTATGTTGCCCTGGACTGG - Intronic
1131968384 15:97869227-97869249 CTGGCTGTGTAGCCTTGGACCGG + Intergenic
1132704457 16:1237113-1237135 GGGGCTGTGCAGGCCTGGAGCGG + Intergenic
1132707059 16:1249312-1249334 GGGGCTGTGCAGGCCTGGAGCGG - Intergenic
1133129166 16:3665638-3665660 GGGGCTGGGGAGCCACAGACAGG - Intronic
1133258435 16:4533202-4533224 AGGGCTGTGAAGCCCATGACAGG - Intronic
1137787965 16:51152580-51152602 CGGGCTGTGTCTCCCTAGGCCGG - Intergenic
1138005908 16:53337450-53337472 AGGGTGGTGTAGCCATAGACTGG - Intergenic
1138605887 16:58088439-58088461 GGGGCTCTGTAGCCCAAGCCTGG - Intergenic
1139883993 16:70196040-70196062 GTGGCTGTTTATCCTTAGACTGG + Intergenic
1140368524 16:74399456-74399478 GCGGCTGTTTATCCTTAGACTGG - Intergenic
1142249060 16:88982867-88982889 GGGGGTGTGGAGCCCAGGACAGG - Intergenic
1148445320 17:47733764-47733786 GGGGCGGCGTAGCCCTCGCCCGG - Exonic
1149431547 17:56598138-56598160 GGGGCTGTGTCTCCCCAGAGTGG + Intergenic
1150813540 17:68375493-68375515 CAGACTGTGTAGCTCTAGACAGG - Intronic
1150850323 17:68698088-68698110 GGGGCTGTGTATCCCTAAGTTGG - Intergenic
1157140708 18:45103385-45103407 GGGGCTGTGTACACCTGCACTGG + Intergenic
1158536091 18:58309445-58309467 GGGGCTTTGGAGCTCTGGACAGG - Intronic
1160952826 19:1675798-1675820 CAGGCTGTGTGGCCCTAGGCAGG - Intergenic
1162145474 19:8610544-8610566 GGGGCTGTGGTGCCCTGGATGGG - Intronic
1162450162 19:10749596-10749618 TGGGCTGTGTGGCCCTGGACAGG - Intronic
1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG + Intergenic
1165782587 19:38442743-38442765 GGGGCTGTGGAGCCCAGAACAGG + Intronic
1166291064 19:41863819-41863841 GGTGCAGTGTAGCCCCGGACAGG + Intronic
1168349319 19:55667090-55667112 GGGTCTGTGTGGCCCCAGTCTGG + Intronic
928869822 2:35963076-35963098 GGGGCTGGGTTGCCAGAGACTGG + Intergenic
934774328 2:96927505-96927527 AGGGCTGTGTTGTCCTAGATCGG - Intronic
937304890 2:120865120-120865142 GGGGCTGGGGAGCCCGAGCCAGG + Intronic
944960669 2:204869170-204869192 GGGGCTTTGTAGCCCTATTAGGG + Intronic
946217741 2:218198777-218198799 GGGGCTGGGTTGCTCTGGACTGG - Intergenic
946414605 2:219533536-219533558 AGGGGTGTGCAGCCCTAGCCTGG + Intronic
948140218 2:235667514-235667536 GGAGCTGTGTAGCCCTGGGGAGG + Intronic
948528611 2:238588953-238588975 GGGGCTGAGTAGTCATAGTCAGG - Intergenic
949022935 2:241751751-241751773 GGGGCTGTGGAGGCTTAGCCTGG + Intronic
1170575223 20:17657444-17657466 GGGCCTGTGCAGCCCGACACAGG + Intronic
1174575680 20:51535436-51535458 GGGCCTGTGTAACCCTTGGCCGG + Intronic
1175166229 20:57046754-57046776 GGGGCTGTGTGACCTTAGGCAGG + Intergenic
1176095757 20:63343671-63343693 GGGGCTGGGAAGCCCTGGCCAGG + Intronic
1177642841 21:23865624-23865646 AGGTCTCTGTTGCCCTAGACTGG - Intergenic
1178336042 21:31744550-31744572 GGGGCTGAGGAGTCCTAGGCTGG + Intergenic
1178534114 21:33398455-33398477 GGAGCTGTGGAGCGCTTGACTGG + Intergenic
1179162315 21:38908691-38908713 GGGGATCTCTAGCCCAAGACAGG + Intergenic
1179917236 21:44485424-44485446 GGGGGGGTGGAGCCCTAGCCGGG - Intergenic
1180054303 21:45349224-45349246 GGGGCTGTGGGGACCCAGACAGG - Intergenic
1184527849 22:45036052-45036074 GTTGCTGTGTAGCCCTGGGCGGG - Intergenic
952826170 3:37526877-37526899 GAGGCTGTGTAGCCCTGCAGTGG - Intronic
954432092 3:50476235-50476257 GGGGCTGTGCAGCTCTGGGCAGG - Intronic
955522854 3:59791942-59791964 GGAGCTGTGCAGCCCCAGAATGG + Intronic
962204911 3:133426301-133426323 GGAGGTGTGGAGCCCTTGACAGG - Intronic
962656623 3:137551863-137551885 GAGGCTGTGTAGGCCTAGGCTGG - Intergenic
969604358 4:8194999-8195021 GGAGCTGTGTGGCCCTGGGCAGG + Intronic
972699582 4:41481331-41481353 GGGGCGGTGAAGCCCTGGGCTGG + Intronic
985037766 4:185858322-185858344 GGGGCTGGGAAGTCCAAGACTGG - Intronic
985341923 4:188963307-188963329 GTGGCTGTGCATCCCTAGATGGG - Intergenic
987284671 5:16443796-16443818 GAGGCTGAGTAGCCAGAGACTGG - Intergenic
997860706 5:137412727-137412749 GGGACTGTGTTGCCCTTCACAGG + Intronic
998003690 5:138643407-138643429 GGGGCTGTGTAACCTGATACAGG - Intronic
999132660 5:149296387-149296409 TGGGCTGTTTATCCCTATACCGG - Intronic
999250177 5:150177891-150177913 GGGGCTGTGGAGCCCAACAGAGG - Intronic
999754652 5:154655332-154655354 GGAGATTTGTAGCCCTACACTGG - Intergenic
1001289821 5:170448941-170448963 CCAGCTGCGTAGCCCTAGACGGG - Intronic
1001406716 5:171482048-171482070 AGGGCTGTGCAGCCCCAGCCAGG + Intergenic
1002000020 5:176192178-176192200 GGGGCAGTGTGGCCCTGGGCAGG - Intergenic
1003175760 6:3751546-3751568 GGGGCTGGGGAGCCCTTGGCGGG - Exonic
1003298849 6:4858517-4858539 GGGGCTGTGTGGCTCTGGGCAGG - Intronic
1009595301 6:65728033-65728055 GGAGCTGTGTAGGCCAAGATGGG - Intergenic
1013694268 6:112682753-112682775 TGAGCTGTGTGGCCCTGGACTGG + Intergenic
1024250355 7:47501531-47501553 GAGGCTCTGGGGCCCTAGACAGG + Intronic
1024537846 7:50452708-50452730 GGTACTTTGTAGCCCTAGACAGG + Intronic
1026890078 7:73976804-73976826 GGGGCTGGGTAGTCCTAGCCAGG + Intergenic
1033399390 7:141007568-141007590 GGGGCTGTGAAGCCATAGTAAGG - Intronic
1035261807 7:157666639-157666661 GGGGCTGTGTGCCACTGGACAGG + Intronic
1037890210 8:22620092-22620114 GGGGCTGCTTAGCCCCAGCCAGG - Exonic
1039474344 8:37831604-37831626 GGGGCTGGGCAGCCCTCTACAGG - Intronic
1046055198 8:109071000-109071022 GGGACTTTGCAGCCCTAGCCTGG + Intergenic
1049541246 8:143210195-143210217 GGGGCTGTGTGGCCCTGTCCTGG - Intergenic
1051194966 9:14554222-14554244 GGGGCTGTGTATCCAGAGAGGGG - Intergenic
1053441539 9:38120460-38120482 GGGTCAGTGCAGCCCTGGACCGG + Intergenic
1054754730 9:68946298-68946320 GGGGCTGTGTAGCCCTAGACTGG - Intronic
1059486441 9:114630791-114630813 AGGGCTGTGTGGCCATGGACTGG - Intronic
1062024611 9:134334600-134334622 GCTGCTGTGTAGCCCTGGGCAGG + Intronic
1062274692 9:135725165-135725187 GCAGCTGTGTGGCCCTCGACAGG - Intronic
1188729582 X:33630597-33630619 GGGGCTGTTGAGCCCTAGGGTGG - Intergenic
1194620226 X:96162043-96162065 GGGGCTGTGAAACCATGGACAGG + Intergenic