ID: 1054755160

View in Genome Browser
Species Human (GRCh38)
Location 9:68950319-68950341
Sequence AACAGCAGAGTGAAATGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 253}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054755160_1054755165 18 Left 1054755160 9:68950319-68950341 CCTGACCATTTCACTCTGCTGTT 0: 1
1: 0
2: 3
3: 23
4: 253
Right 1054755165 9:68950360-68950382 GTTGCACTCTTGGGTGAAGCTGG No data
1054755160_1054755163 8 Left 1054755160 9:68950319-68950341 CCTGACCATTTCACTCTGCTGTT 0: 1
1: 0
2: 3
3: 23
4: 253
Right 1054755163 9:68950350-68950372 CCACGTGACAGTTGCACTCTTGG No data
1054755160_1054755164 9 Left 1054755160 9:68950319-68950341 CCTGACCATTTCACTCTGCTGTT 0: 1
1: 0
2: 3
3: 23
4: 253
Right 1054755164 9:68950351-68950373 CACGTGACAGTTGCACTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054755160 Original CRISPR AACAGCAGAGTGAAATGGTC AGG (reversed) Intronic
901252400 1:7790533-7790555 AAGAGCAGAATGATATGGTTTGG - Intronic
903766644 1:25739516-25739538 ATTAGCAAAGAGAAATGGTCAGG - Intronic
905141736 1:35851423-35851445 AAAAGCAAAGTGAACTGGTCAGG - Intronic
905231469 1:36517170-36517192 CACAGCAGAATGGAGTGGTCAGG - Intergenic
906300500 1:44678093-44678115 AAGAGCAGAGTAAAAAGGTTGGG + Intronic
906553936 1:46691821-46691843 TACTGCAGAGTGATATGGTAAGG - Exonic
907615402 1:55919563-55919585 CACAGGTGAGTGATATGGTCAGG + Intergenic
908418404 1:63935405-63935427 AGAGACAGAGTGAAATGGTCAGG + Intronic
910162830 1:84292373-84292395 AGCGGAAGAGTGACATGGTCAGG - Intergenic
912212027 1:107567081-107567103 TACAGAAGAGTGAAAAGGTATGG - Intergenic
915510993 1:156387020-156387042 GCCAGCAGAGGGAAAGGGTCAGG - Intergenic
915770282 1:158415052-158415074 AAAAGTAGAGTGGAATGGTTGGG + Intergenic
917213009 1:172649153-172649175 AACAGCAGACTGACATGATTAGG + Intergenic
917695640 1:177520435-177520457 AAGAGCAGAGTGTGATGTTCTGG + Intergenic
918129053 1:181608937-181608959 GGCAGAAGATTGAAATGGTCAGG - Intronic
918767103 1:188500307-188500329 AGAAGCAGAGTGATATGGTTTGG + Intergenic
918811581 1:189128262-189128284 AACAGCAAAATGAAAAAGTCAGG + Intergenic
919853845 1:201692493-201692515 AACAGGAGTTTGTAATGGTCTGG + Intronic
921399353 1:214703498-214703520 AAGTGCAGAGTGAAGAGGTCGGG - Intergenic
921643727 1:217587598-217587620 AACAGTAGTGTGAAATTGTGGGG + Intronic
922243506 1:223773017-223773039 AACAGAGGAGTGAAGTGGTGAGG + Intronic
924647636 1:245893909-245893931 AACAGCATAGTGAAGAGGTTAGG + Intronic
1062982837 10:1739808-1739830 AACAGCAGAGTGAGACGTGCTGG - Intergenic
1062997756 10:1882587-1882609 AACTCTAGAGTAAAATGGTCTGG + Intergenic
1064121679 10:12624515-12624537 ATCATCTGAGTGAAATGGGCCGG - Intronic
1065592039 10:27272665-27272687 AACCTAAGAGTGAAATGGTAAGG + Intergenic
1067035628 10:42914398-42914420 AACAGGAAAGTGAACTGGTTTGG + Intergenic
1067205690 10:44210092-44210114 AACAGAACATTGAAAAGGTCAGG - Intergenic
1067247997 10:44562283-44562305 AACAGCAGAATAAGGTGGTCGGG - Intergenic
1069012220 10:63386704-63386726 AACACCAAAGTGAAATGCTTGGG + Intronic
1070634929 10:78117633-78117655 AACAGAAGAGTAAGATGATCAGG - Intergenic
1071444997 10:85737263-85737285 AAAAGAAGAGTGAAATGGAAAGG + Intronic
1071668286 10:87581904-87581926 TTCAGCAGACTGAAATGGTATGG + Intergenic
1071948207 10:90672083-90672105 CACAGCACAGTAAAATGGTGGGG - Intergenic
1073979989 10:109143441-109143463 AGCAGCAGAATGATATGGTTTGG + Intergenic
1074886193 10:117695718-117695740 TACAGCAGCCTGAAATGGTTTGG + Intergenic
1075136547 10:119791217-119791239 AACTGAAGAGTGAAATGTTCCGG - Intronic
1075915090 10:126159968-126159990 AGCAGCAGTGGGACATGGTCAGG - Intronic
1080189245 11:29525061-29525083 ATCAGCCGAGTGGGATGGTCTGG - Intergenic
1080319322 11:30988115-30988137 AGCAGGAGAGTGAAATTATCTGG + Intronic
1083997960 11:66281511-66281533 AGCAGCAGAGTGGGGTGGTCAGG - Intronic
1085319164 11:75563695-75563717 AACAGAAGAGTGAAGAGGGCGGG - Exonic
1086330759 11:85751763-85751785 AACAGCATGGTGAAATTGTAAGG - Intronic
1086947250 11:92855180-92855202 AACAGCAGAGTCAGCTGGTAGGG + Intronic
1087657436 11:100941357-100941379 AACAAAGGAGTGAAATGGCCTGG + Intronic
1090257409 11:125294985-125295007 AACAGGAAAGTGAACTAGTCAGG + Intronic
1090779230 11:129992093-129992115 TACACCTGAGTGAAATGGTCTGG - Intronic
1091755050 12:3045847-3045869 AACAGCAGGGAGAGGTGGTCAGG + Intergenic
1093192468 12:16091260-16091282 AAGGGCAGAATGATATGGTCTGG - Intergenic
1094497409 12:30997086-30997108 CACAGTAGAGTGAGTTGGTCTGG - Intergenic
1095131181 12:38544494-38544516 AACAGCAGCATGCAATGGGCTGG - Intergenic
1095443424 12:42260672-42260694 AACAGCTTAGTGGAATTGTCAGG + Intronic
1095919838 12:47518056-47518078 AAATGCAGAGTGAAGTGGTAAGG + Intergenic
1097956938 12:65495823-65495845 AACAGAAGCGTGAAATGTGCTGG + Intergenic
1098455492 12:70668180-70668202 AGCAGCATAGTGTAATGGTGAGG + Intronic
1098941581 12:76542724-76542746 AACAAAGGAGTGAAATGGTCAGG - Intronic
1100572872 12:95859202-95859224 AAAAGCAGAGTGAAAGGAGCTGG - Intronic
1100852800 12:98731032-98731054 GGCAGCAGAGTGTAATGGTCAGG + Intronic
1100882930 12:99038543-99038565 AACAGGAGAGAGATATGGTTTGG - Intronic
1101228144 12:102710281-102710303 AAAATCAGAGTGAGATGGTAGGG + Intergenic
1102009181 12:109607552-109607574 AACAGCAGAGGCAAAGGGCCTGG - Intergenic
1102137981 12:110591243-110591265 AACAGCAGTGTCTAAAGGTCAGG - Intergenic
1102762871 12:115404203-115404225 AACAGAGGAGTGCCATGGTCTGG + Intergenic
1105686856 13:22792718-22792740 AATAGGAGAGTGAAGTGATCGGG + Intergenic
1105792293 13:23813766-23813788 AACAGCAGATTGAAATTATTTGG - Intronic
1105966693 13:25391068-25391090 GACAGTAGATTTAAATGGTCAGG + Intronic
1106388822 13:29315849-29315871 AACAGCATAGTGAGATGGCAAGG + Intronic
1108028166 13:46200356-46200378 AGCAGCAGAGAGAAAGGGTTGGG + Intronic
1109387211 13:61646607-61646629 AACAGAAGAGTGACATGGTCTGG + Intergenic
1113160155 13:107370856-107370878 AAGTGCAGAGTGAAGTGGTGGGG + Intronic
1113618092 13:111695171-111695193 TAGAACAGAGTGATATGGTCGGG + Intergenic
1113623625 13:111780432-111780454 TAGAACAGAGTGATATGGTCGGG + Intergenic
1114548399 14:23519440-23519462 AACAGGAGAGAGAAAAGGACAGG + Intergenic
1114574131 14:23696934-23696956 ATCAGCCGAGTCAAATGGTCTGG - Intergenic
1116691927 14:48118641-48118663 ACCAGCAGATTGATATAGTCTGG - Intergenic
1117195473 14:53335981-53336003 AACGGCAGCGTGAAATGCTCAGG + Intergenic
1117203790 14:53419271-53419293 AAGGGCAGAATGATATGGTCTGG + Intergenic
1118676401 14:68189575-68189597 AACAGCAGAGAGATATGGTTAGG + Intronic
1122063745 14:99157567-99157589 AACAGCAGAGCCAACTGGCCCGG + Intergenic
1125478330 15:40062801-40062823 GAGAGCAGAGTGAAAGGATCTGG + Intergenic
1130866935 15:87941175-87941197 AACAGCAGAGGGACATGACCTGG - Intronic
1132844822 16:1995444-1995466 AACATAAGAGTGAAATCATCAGG - Intergenic
1135618474 16:23932589-23932611 AACAGCAGACTGGAAGGATCAGG + Intronic
1135862621 16:26070767-26070789 AACTGCAAAGTGATATGATCAGG - Intronic
1141399416 16:83733973-83733995 AAAAGCAGAATAAAATAGTCTGG - Intronic
1141789313 16:86223581-86223603 AACAGCAGTAAGAAAGGGTCTGG + Intergenic
1142176631 16:88648231-88648253 CACAGCACAGTGACAGGGTCGGG + Intronic
1142595871 17:1029720-1029742 AGCAGCAGAGTCAAAGGGCCAGG - Intronic
1142704146 17:1683838-1683860 AAAAACAGAGTAAAATGGTAAGG - Intronic
1144019754 17:11229729-11229751 GACAGCAGTGTGAAATGAGCAGG + Intergenic
1144301728 17:13927643-13927665 AATAGCTGAGGGAAATGGGCTGG + Intergenic
1144304961 17:13961580-13961602 GAAAGCACAGTGAAATTGTCTGG + Intergenic
1144308390 17:13990302-13990324 AACAGCTGATTGATATGGTTTGG + Intergenic
1144605064 17:16657781-16657803 AGCAGCAGAATGATATGGTTTGG - Intergenic
1146683501 17:34825016-34825038 AGCAGGAGAGTGACATGGCCAGG - Intergenic
1147695531 17:42349648-42349670 AACATCCCAGTGAAATGCTCTGG + Intronic
1147981615 17:44278302-44278324 AACAAGAGAATGAAGTGGTCAGG + Intergenic
1149058192 17:52389938-52389960 GGCAGCAGAGTCAAGTGGTCTGG - Intergenic
1150703335 17:67466516-67466538 AACAGCAAAGAGAAAGGGCCAGG + Intronic
1152173184 17:78767749-78767771 AACACCAGAATGAAAGGGCCAGG + Intronic
1152459713 17:80435450-80435472 AACAACAAAGCAAAATGGTCTGG - Intronic
1152674156 17:81628650-81628672 AACACCAGACAGAAATAGTCTGG + Intronic
1156554746 18:38054452-38054474 AATAGCAAGGTGACATGGTCTGG + Intergenic
1156951028 18:42897996-42898018 TAGAGGAGGGTGAAATGGTCAGG + Intronic
1157082418 18:44540205-44540227 AATTGCAGAAGGAAATGGTCTGG - Intergenic
1157616246 18:48989313-48989335 GAAAGCAGAGAGAAATGGGCTGG - Intergenic
1157649187 18:49310666-49310688 AGCAACAAAGTGAAATGGCCTGG - Intronic
1157790828 18:50529535-50529557 AAAAGCAAAGTGAGAAGGTCTGG + Intergenic
1157871626 18:51234866-51234888 AACACCAGAGTAAAATGATAAGG - Intergenic
1159230458 18:65600962-65600984 AAAAGCAAAGTAAAATGTTCTGG + Intergenic
1159485794 18:69055629-69055651 AAAAGCAGAGAAACATGGTCAGG - Intergenic
1159829144 18:73251809-73251831 AACTGCATAGTGAAAAGGACAGG - Intronic
1163702452 19:18792919-18792941 ATCAGCAGAGGGAAAAGGTGAGG + Intergenic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
1166364410 19:42271226-42271248 GGCAGCACACTGAAATGGTCAGG + Intronic
1166728132 19:45041283-45041305 GACAGGAGAGGGAAGTGGTCAGG - Intronic
1167842439 19:52132957-52132979 AGCAGCAGAGGAAAATGGTCAGG + Intronic
927362175 2:22248823-22248845 AATAGAAATGTGAAATGGTCAGG - Intergenic
927441189 2:23119222-23119244 AACAGCAGAGTTGAGTGGGCAGG + Intergenic
928129351 2:28638439-28638461 AGCAGTAGAGTGATATGCTCTGG + Intronic
928419094 2:31123708-31123730 AACGGAAGAGTGACATGATCAGG + Intronic
930907473 2:56589454-56589476 AAAATCAGAGTGAAATGTTGAGG - Intergenic
931400097 2:61924130-61924152 CACTGCAGAGTGACATGGTTTGG - Intronic
931629134 2:64283738-64283760 AACAGCATAGAGAAGAGGTCTGG + Intergenic
933697961 2:85234427-85234449 AAAATCAGAGTGGAATGGCCAGG - Intronic
935187872 2:100750768-100750790 AACAGTACAGTGAAATGGGTTGG - Intergenic
937971182 2:127550636-127550658 AGGAGCAAAGTGAGATGGTCAGG + Intronic
939274606 2:139984901-139984923 ATCAACAGAGTGAAATGGTTTGG - Intergenic
939672364 2:145028681-145028703 AAGAGCAGTGTGAAATGGAAGGG + Intergenic
940389290 2:153112584-153112606 AACAGAAGATTAACATGGTCAGG - Intergenic
941445833 2:165598542-165598564 AACAGCAGATTGAAATGGCCTGG + Intronic
941801009 2:169659664-169659686 AAGAGCAGAATGATATGGTTTGG - Intronic
942135450 2:172920526-172920548 AGCAGCAGAGTGATATGATCAGG - Intronic
942352216 2:175064945-175064967 CACCGCAGAGTGAAGTGCTCTGG + Intergenic
942442920 2:176054700-176054722 AATAGTAGAATGACATGGTCAGG + Intergenic
943127729 2:183816509-183816531 AACAGCACAGGGAAGAGGTCTGG + Intergenic
945265149 2:207883310-207883332 AACATCAGAGTCCAATGGTGAGG + Intronic
946319593 2:218944201-218944223 AACAGAAGAGTGACATGATCTGG + Intergenic
946431710 2:219629905-219629927 AAGAGCAGAGTGAAGAGGTTAGG + Intronic
946574695 2:221062111-221062133 ATCATCAGAGTGACATGGTTTGG + Intergenic
948545321 2:238724076-238724098 AACATCAGAATGATATGGTTTGG - Intergenic
948610520 2:239163573-239163595 ACCTCCAGAGTGACATGGTCTGG - Intronic
1169852964 20:10072860-10072882 AGCAGCAGAGTGACATATTCAGG + Intergenic
1169933695 20:10860281-10860303 AATAGATGAGTGACATGGTCTGG - Intergenic
1170552703 20:17491024-17491046 AACAGCAGAGTGAGAGGGCTGGG + Intergenic
1170993623 20:21329457-21329479 AACTGCAGAGTGCAATTATCCGG - Intronic
1173035576 20:39406058-39406080 AGCAGCAGAGTGAAAAAGTGTGG - Intergenic
1173314399 20:41930587-41930609 AAAGGCAGAGTGATATGGTTGGG - Intergenic
1174508216 20:51030793-51030815 GACAGCTGAGTGGAATGCTCTGG + Intergenic
1174666155 20:52259963-52259985 AACTGCAGATTGTATTGGTCTGG - Intergenic
1174955475 20:55093162-55093184 AACAGGAGAGTAAAATGGGGTGG - Intergenic
1175607779 20:60325044-60325066 AGCAGCAGAGTTTAGTGGTCAGG + Intergenic
1177008452 21:15702616-15702638 AACAGCAGTGTGGTATGGTATGG - Intergenic
1177825581 21:26079378-26079400 AACAGCAAGCTGAAATGGTGTGG + Intronic
1179014056 21:37579592-37579614 AAAAGCAGAGAGAAATGTTGTGG - Intergenic
1179092469 21:38279517-38279539 AGCAGCAGACTGAAATGCTATGG + Intronic
1181936827 22:26445007-26445029 AAAACCAGAGTGAAGTGGTGAGG + Exonic
1182285832 22:29246336-29246358 AGCAGCAGAGTGATGCGGTCAGG + Intronic
1182300861 22:29336119-29336141 ACCAGCAGACTCAAATGGTGAGG + Intronic
1182803040 22:33047472-33047494 AACAGCTGAATTAAATGTTCGGG - Intronic
1184881644 22:47308678-47308700 AACAGAAGGGAGAAATGGTTTGG - Intergenic
950641479 3:14351306-14351328 ATAAGCAGAGTGACATGCTCTGG - Intergenic
950791881 3:15478675-15478697 GGTAGCAGAGTGAGATGGTCTGG + Intronic
950983302 3:17332152-17332174 TACAGAAGAGTGAAGTGGCCTGG + Intronic
952093817 3:29924142-29924164 CAGAGCAGAGTGGAATGGTTTGG - Intronic
953229782 3:41054507-41054529 AAAAGCTGAGTGATATGGTTTGG - Intergenic
954434100 3:50486871-50486893 TACTGCAGAGTGAGGTGGTCAGG - Intronic
954641041 3:52098020-52098042 CACAGCAGAGTGCAGTGGTGAGG + Intronic
955590867 3:60533855-60533877 AAGAGAAGAATGATATGGTCAGG + Intronic
955837518 3:63072931-63072953 GACAGCTGAGTGTTATGGTCAGG + Intergenic
955896329 3:63704744-63704766 GACTCCAGAGTGAAATGATCTGG + Intergenic
955918769 3:63932692-63932714 AGGAGCAGAGGGAAATTGTCTGG - Intronic
957571153 3:81949077-81949099 AAAAGCAGAGACAAATGTTCTGG - Intergenic
957953054 3:87149438-87149460 AACAGCAGAATGATATGATTTGG - Intergenic
958873108 3:99584539-99584561 AACAACAGACTGAAATGCTCTGG - Intergenic
959172403 3:102859370-102859392 AAGAGCAGAATGATATGGTTTGG - Intergenic
959692043 3:109208347-109208369 AAAAGGAGAGTGAAATGGAGTGG - Intergenic
960855755 3:122100667-122100689 AACAGTAGAGTGTATTGCTCAGG + Intronic
964252317 3:154732926-154732948 AGCAGGAGAGTGACATGGTTTGG + Intergenic
965841931 3:172916251-172916273 AACAGAAAAGTGATATGGTCTGG - Intronic
966324225 3:178736458-178736480 AGCTGCAGAGTGAAAAGGTCTGG - Intronic
966607178 3:181833083-181833105 AACAGCAGAATGAGAGGGACAGG - Intergenic
967455813 3:189685266-189685288 AAAGGCAGAGTCAAATGGACTGG + Intronic
968793681 4:2687760-2687782 AACAGCAGAGTGAGATGATTTGG - Intronic
969207702 4:5659915-5659937 AAAAGTAGAGTGAAATGATTTGG - Intronic
970790606 4:19853867-19853889 AGGAGCAGAATGATATGGTCTGG - Intergenic
970950337 4:21748244-21748266 AAGAGCAGAGTCAAAGGGTTGGG + Intronic
974606484 4:64158047-64158069 TACAGCAGTGTGATATGGTTTGG - Intergenic
974625250 4:64418172-64418194 AAGGGCAGAGTGGAATGATCTGG - Intergenic
980585785 4:134814729-134814751 AACAGCAAAGTAAAATGGATAGG + Intergenic
980972580 4:139580918-139580940 AAAAGCAGGGTGATATGGTTTGG - Intronic
981474515 4:145175426-145175448 AACTGCAGAGTGAGAGGATCTGG - Intronic
983296031 4:165870429-165870451 AAAATAAGAGTTAAATGGTCTGG + Intergenic
984571756 4:181403670-181403692 AATAGCAGAATGATATGGTTTGG - Intergenic
985011262 4:185584523-185584545 AACAGCAGGAAGAAATGATCAGG + Intergenic
985937763 5:3109846-3109868 AACACCAGAATAAAATGGTTTGG + Intergenic
986153249 5:5147261-5147283 GACAGCAGAGTGAAAATGTGTGG + Intronic
986546233 5:8900869-8900891 AACAGGAGAGTAGAATGATCAGG + Intergenic
986863407 5:11954200-11954222 AACAGAAAAGTGAAATGGTCAGG - Intergenic
986966449 5:13278058-13278080 AACTAGAGAGTGCAATGGTCTGG + Intergenic
987197034 5:15536838-15536860 AAGGGCAGAGTGATATGGTTTGG + Intronic
987825821 5:23028951-23028973 ACCTGCAGCGTGAAATTGTCTGG - Intergenic
993586005 5:89729054-89729076 AACAGCAGAGCCAAATGCTAAGG + Intergenic
996522497 5:124442515-124442537 AACAGGAGATTGATATGGTTTGG - Intergenic
997714619 5:136032917-136032939 AAAAGCAGAGTGTAAATGTCTGG - Intronic
998153808 5:139772544-139772566 AACAGCAGAGAGAAAAGGAGGGG - Intergenic
998259778 5:140621170-140621192 AACAGAAGAGAGAAATGTCCTGG - Intergenic
998797969 5:145838911-145838933 AAAAGCAGAGAGACAGGGTCAGG - Intergenic
998944299 5:147321022-147321044 AACAGCCTATTGCAATGGTCTGG + Intronic
999310605 5:150549358-150549380 AGCAGGAGAGTGACATGGACTGG + Intronic
999896185 5:156036363-156036385 ATCAGCAGAAAGAAATGTTCAGG + Intronic
1000128867 5:158275307-158275329 ATCAGGAGAGTGATAGGGTCAGG - Intergenic
1003317660 6:5026598-5026620 AACAGCAGAGTCACCTGCTCCGG - Intergenic
1003825251 6:9945131-9945153 AACAGCAGTGTGGAATGGACTGG + Intronic
1004503321 6:16227815-16227837 ATCAGCCGGGTCAAATGGTCTGG + Intergenic
1008391052 6:50952259-50952281 AACTTCAGTGTGAAATGGCCTGG - Intergenic
1009555322 6:65156692-65156714 AATATCAGAGGGAAATGGTCTGG - Intronic
1010380468 6:75218268-75218290 AAAAGCAGAGTGACATGGTGAGG - Intergenic
1015849130 6:137553392-137553414 ATGAGCAGAGTGACCTGGTCTGG + Intergenic
1019943108 7:4306658-4306680 ATTTGCAGAGTGAAATGCTCAGG + Intergenic
1020982812 7:15093004-15093026 AGGAGAAGAGTGACATGGTCTGG + Intergenic
1021339223 7:19442418-19442440 CACTGTAGAGTAAAATGGTCAGG + Intergenic
1022214084 7:28240791-28240813 CACAGCAGAGTGAGAGGGACAGG - Intergenic
1022793036 7:33707645-33707667 AACAGCTGTGAGAAATGTTCTGG + Intergenic
1023090494 7:36613639-36613661 AACAGGAGAGCAAAGTGGTCAGG - Intronic
1023798864 7:43815536-43815558 AACAGCAGAGAGGAAAGGTGGGG + Intergenic
1024116651 7:46200520-46200542 AACACCAAAGAGAAATGCTCCGG - Intergenic
1024510645 7:50201934-50201956 AATAGAAGAGGGAAATGGTGAGG - Intergenic
1024775564 7:52781375-52781397 AGCAACAGAGTGGAATGGCCAGG + Intergenic
1027514391 7:79123964-79123986 AACAGGACAGTGAAAAGGTGAGG - Intronic
1027529307 7:79310969-79310991 AAGAGGAGAGTGAAATGGAGAGG - Intronic
1028290559 7:89059636-89059658 AATAACAAAGTGATATGGTCTGG - Intronic
1028936182 7:96466373-96466395 AACAGCACAGGGAAATGCCCAGG - Intergenic
1030254570 7:107494280-107494302 AATGGCAGAGTGAACTGGTCAGG + Intronic
1031167514 7:118247131-118247153 AACTGCAAATTGAAATGGTGTGG - Intergenic
1031599981 7:123695439-123695461 AACAGGAGAATGAAAAGATCTGG + Intronic
1032950006 7:136897068-136897090 AAGAGCAGAATGTATTGGTCTGG + Intronic
1033622948 7:143078288-143078310 GGCAGGAGAGTGAAATGGACAGG - Intergenic
1036095279 8:5717360-5717382 AGCAGCAGAGGCACATGGTCAGG - Intergenic
1036193484 8:6693276-6693298 TACAGAAGAGAGAAATGGTTTGG + Intergenic
1037571311 8:20159954-20159976 ATCAGCAGAGTGAGTTTGTCTGG + Intronic
1039164718 8:34665130-34665152 AACAGAAGAGTGAAATTATAGGG - Intergenic
1040285899 8:46100226-46100248 AACTGCAAGGTGGAATGGTCGGG - Intergenic
1040339834 8:46434936-46434958 GACAGCAGGGTGGAGTGGTCGGG - Intergenic
1040421060 8:47241009-47241031 AACATCAGAGTCAAAGGGTGAGG + Intergenic
1042366789 8:67946293-67946315 AAAAACAGAGTGAAAGGGCCAGG - Intergenic
1042407431 8:68422098-68422120 AGCAGCAGAATGACATGGTTTGG - Intronic
1043440225 8:80270239-80270261 AACTTCAGAGTCAAAAGGTCTGG + Intergenic
1043781587 8:84342771-84342793 TACAGCAGAAGAAAATGGTCTGG + Intronic
1045529182 8:102968388-102968410 AAGACCAGAGTGAAAAGGTCAGG + Intronic
1047750575 8:127877290-127877312 AACAGCAGCGTGAAAAGGGCGGG - Intergenic
1048233451 8:132666671-132666693 AACAGCACAGTGCAAAGGCCAGG + Intronic
1048288192 8:133158760-133158782 AGCAGCTGAATGACATGGTCAGG - Intergenic
1048694653 8:137012506-137012528 AGCAGCAGAATGATATGGTTTGG - Intergenic
1049549065 8:143248111-143248133 AAAAGCAGAGTGGACTGGCCGGG - Intronic
1051237419 9:15016447-15016469 AACTGCAGATTGAAATACTCAGG - Intergenic
1054595220 9:67059023-67059045 AACAGCAGAGTGATAAAGCCTGG + Intergenic
1054755160 9:68950319-68950341 AACAGCAGAGTGAAATGGTCAGG - Intronic
1055452114 9:76440505-76440527 AACATCATAGTGAAAAGGACCGG - Intronic
1056547262 9:87623141-87623163 AACAGCTGAGTAAAGTGGTCTGG + Intronic
1057303012 9:93897209-93897231 GACAGCAGAGTGCAATGCCCAGG + Intergenic
1057316634 9:93973222-93973244 AAATGCAGAGTGATATGGTTTGG - Intergenic
1057704288 9:97386647-97386669 AACAGCAGGGTGACAGGGCCCGG + Intergenic
1058791043 9:108445880-108445902 AACATCAGTGTGAACTGGTTTGG + Intergenic
1059156920 9:111998218-111998240 AAGAGCAGGGTGCACTGGTCTGG + Intergenic
1059581625 9:115555707-115555729 AAGGGCAGAGTGATATGGTTTGG - Intergenic
1186619623 X:11224861-11224883 AATAGCTGAGTGGAGTGGTCAGG + Intronic
1187972246 X:24670682-24670704 AGCAGCATAGGCAAATGGTCAGG + Intronic
1189178177 X:38978986-38979008 AACAGCAGAGGGGAAGGGCCAGG - Intergenic
1190746530 X:53326422-53326444 AACAGGAGAGTGACACGGTAGGG + Intergenic
1191884465 X:65874433-65874455 AACAGCACAGTGACAGGGACAGG + Intergenic
1192134968 X:68588696-68588718 AACTGCAGACTGAAGTGCTCTGG + Intergenic
1192811255 X:74549099-74549121 ACCAGAAGAGTGACATGGGCTGG + Intergenic
1193471196 X:81906653-81906675 AGCAGCAGAATGATATGGTTTGG - Intergenic
1195845570 X:109224049-109224071 AAGAGCAGAATGAAAGGGGCAGG + Intergenic
1196080810 X:111628414-111628436 AACAGCAGATTGTCATTGTCTGG - Intergenic
1196793203 X:119482580-119482602 AGCAGCAGAAGGAAATGGCCCGG + Intergenic
1198809318 X:140519499-140519521 AGCAGGGGAGTGACATGGTCAGG + Intergenic
1201116373 Y:10838358-10838380 AACAGTGGAGTGAAATGGAGTGG - Intergenic
1201116495 Y:10839181-10839203 AACAGTGGAGTGAAATGGAATGG - Intergenic