ID: 1054762072

View in Genome Browser
Species Human (GRCh38)
Location 9:69012870-69012892
Sequence CAGGAAGCCCAGATATTTGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 351}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054762072_1054762079 0 Left 1054762072 9:69012870-69012892 CCTCCAAATATCTGGGCTTCCTG 0: 1
1: 0
2: 1
3: 25
4: 351
Right 1054762079 9:69012893-69012915 CTCCCCCAACCCTGGAGGGTGGG 0: 1
1: 0
2: 1
3: 33
4: 349
1054762072_1054762074 -8 Left 1054762072 9:69012870-69012892 CCTCCAAATATCTGGGCTTCCTG 0: 1
1: 0
2: 1
3: 25
4: 351
Right 1054762074 9:69012885-69012907 GCTTCCTGCTCCCCCAACCCTGG 0: 1
1: 0
2: 4
3: 43
4: 526
1054762072_1054762075 -5 Left 1054762072 9:69012870-69012892 CCTCCAAATATCTGGGCTTCCTG 0: 1
1: 0
2: 1
3: 25
4: 351
Right 1054762075 9:69012888-69012910 TCCTGCTCCCCCAACCCTGGAGG 0: 1
1: 0
2: 4
3: 37
4: 365
1054762072_1054762077 -4 Left 1054762072 9:69012870-69012892 CCTCCAAATATCTGGGCTTCCTG 0: 1
1: 0
2: 1
3: 25
4: 351
Right 1054762077 9:69012889-69012911 CCTGCTCCCCCAACCCTGGAGGG 0: 1
1: 0
2: 4
3: 41
4: 348
1054762072_1054762085 6 Left 1054762072 9:69012870-69012892 CCTCCAAATATCTGGGCTTCCTG 0: 1
1: 0
2: 1
3: 25
4: 351
Right 1054762085 9:69012899-69012921 CAACCCTGGAGGGTGGGGTGAGG 0: 1
1: 1
2: 3
3: 73
4: 656
1054762072_1054762088 24 Left 1054762072 9:69012870-69012892 CCTCCAAATATCTGGGCTTCCTG 0: 1
1: 0
2: 1
3: 25
4: 351
Right 1054762088 9:69012917-69012939 TGAGGATGAAATTAGATACAAGG 0: 1
1: 0
2: 3
3: 47
4: 296
1054762072_1054762080 1 Left 1054762072 9:69012870-69012892 CCTCCAAATATCTGGGCTTCCTG 0: 1
1: 0
2: 1
3: 25
4: 351
Right 1054762080 9:69012894-69012916 TCCCCCAACCCTGGAGGGTGGGG 0: 1
1: 0
2: 3
3: 39
4: 435
1054762072_1054762078 -1 Left 1054762072 9:69012870-69012892 CCTCCAAATATCTGGGCTTCCTG 0: 1
1: 0
2: 1
3: 25
4: 351
Right 1054762078 9:69012892-69012914 GCTCCCCCAACCCTGGAGGGTGG 0: 1
1: 0
2: 1
3: 21
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054762072 Original CRISPR CAGGAAGCCCAGATATTTGG AGG (reversed) Exonic
900664867 1:3808396-3808418 CAGTAATCCCAGCTAGTTGGAGG - Intergenic
900940454 1:5795321-5795343 CAGGCTGACCAGATATTTGCGGG - Intergenic
901925185 1:12561599-12561621 TGGGAGGCCCTGATATTTGGAGG - Intergenic
903132549 1:21289554-21289576 CAGGAAACTCAGGTATTGGGAGG + Intronic
903328198 1:22583259-22583281 CAGGGAGCCCAGAGACCTGGAGG - Intronic
903539271 1:24087588-24087610 CAGGAAGCCAAGAGATTTCTCGG - Intronic
904315971 1:29663722-29663744 CAGATATCCCTGATATTTGGAGG + Intergenic
904598003 1:31658756-31658778 CTGGAAGGCGAGATCTTTGGAGG + Intronic
905120701 1:35679636-35679658 CAGGAGGCCTAGAGATGTGGGGG - Intergenic
905134590 1:35788660-35788682 CTGTAATCCCAGATACTTGGGGG + Intergenic
907522746 1:55035057-55035079 TAGGAAGCCCAGACATGTGGTGG - Intergenic
907948960 1:59162364-59162386 CAGGATGCCCAGATCTGTGGTGG - Intergenic
908232843 1:62122700-62122722 CTGTAATCCCAGCTATTTGGAGG + Intronic
908410776 1:63862485-63862507 TACAAAGCCAAGATATTTGGCGG - Intronic
910459877 1:87437341-87437363 CAGGAAGCACTGAGATTTGGAGG + Intergenic
910930423 1:92437924-92437946 CAGGAAGCCCACAGAACTGGAGG + Intergenic
911524406 1:98966579-98966601 CAGGAAGCCCTAATATTCTGGGG + Intronic
911833741 1:102589034-102589056 CTGGAAGCTCAGATAATTGTTGG - Intergenic
914317091 1:146523609-146523631 AAGCAAGCACTGATATTTGGAGG + Intergenic
914497264 1:148209751-148209773 AAGCAAGCACTGATATTTGGAGG - Intergenic
914716177 1:150257047-150257069 CAGGGAGCCCAGATCTAGGGCGG - Intergenic
914925759 1:151885239-151885261 CTGTAATCCCAGCTATTTGGGGG - Intronic
915177802 1:154031210-154031232 CTGTAATCCCAGCTATTTGGGGG - Intronic
915317862 1:155039672-155039694 GAGGAGGCCCAGATATGGGGAGG - Intronic
916740679 1:167644671-167644693 CAGGCAACCCAGGTATGTGGGGG - Intronic
917999577 1:180479680-180479702 CAGGTACCCCATATATTTGTAGG + Intronic
918253260 1:182723676-182723698 CAGGAAGCCCAGGTCCTTGGGGG + Intergenic
918277851 1:182971102-182971124 CAGGTAGCTCAGATAGGTGGAGG - Intergenic
919299046 1:195737997-195738019 CAACAAGCCCAGGTATCTGGTGG - Intergenic
919594065 1:199539553-199539575 CAGGAATGCCAGTTATTTGTGGG - Intergenic
920839247 1:209540155-209540177 CATAAATCCCAGATATTTGGGGG - Intergenic
921041977 1:211441376-211441398 CTGTAATCCCAGCTATTTGGGGG + Intergenic
921437346 1:215139658-215139680 CTGCAATCCCAGCTATTTGGGGG + Intronic
921663745 1:217840734-217840756 CTGGAGTCCCAGCTATTTGGAGG + Intronic
923195886 1:231666923-231666945 CAGGAAGCCCAGAGGGTTTGAGG - Intronic
923791068 1:237111753-237111775 CAGAAAGCTCTGAGATTTGGAGG + Intronic
924120731 1:240795060-240795082 CTGTAATCCCAGTTATTTGGAGG + Intronic
1063065636 10:2605871-2605893 CATAAAACCCAGATATTTTGGGG - Intergenic
1063725764 10:8635761-8635783 CAGGCAGCCCAGATTTATGAAGG - Intergenic
1065823145 10:29544879-29544901 CAGGGAGCACAGGTGTTTGGGGG + Intronic
1065861458 10:29875875-29875897 CAGGAAGCCCAGGCACTCGGGGG - Intergenic
1066660612 10:37735692-37735714 CTGTAATCCCAGATACTTGGAGG + Intergenic
1068502983 10:57863815-57863837 CAGCAAGCCCAAATAGATGGAGG + Intergenic
1069332284 10:67306852-67306874 CAGGAAAGCCAGATATGTGAAGG - Intronic
1069950260 10:72013798-72013820 GAGAAAACCCAGGTATTTGGGGG + Intergenic
1070114253 10:73513936-73513958 CTGTAATCCCAGCTATTTGGGGG - Intronic
1071581620 10:86776841-86776863 CAGGAAGTCAAGATATTAAGAGG - Intronic
1072432900 10:95389338-95389360 CAGGAAGCCCAGAGAGCTTGGGG + Intronic
1072713768 10:97735916-97735938 CAGGTAGCCCAGAAATATGGAGG + Intergenic
1073394066 10:103203736-103203758 CAGGAAGCCTATATTCTTGGTGG + Intergenic
1073397294 10:103228668-103228690 CTGTAATCCCAGCTATTTGGGGG + Intergenic
1074836341 10:117299438-117299460 CAGGAACACCAGTTATTTGTAGG + Intronic
1075040263 10:119102501-119102523 CAGGAAGCCCAGAGAATAGAAGG + Intergenic
1077213215 11:1383012-1383034 CAGGAAGCCCAGCTCTCAGGCGG + Intergenic
1078472262 11:11600054-11600076 CAGGAAGCACAAAAATATGGAGG - Intronic
1079057228 11:17216730-17216752 CAGGAAGACCAGTTAGATGGTGG - Intronic
1079221994 11:18571222-18571244 CTGTAATCCCAGATACTTGGGGG + Intronic
1080124474 11:28716073-28716095 CAGGATGCCCAGATACTTCCCGG - Intergenic
1080729025 11:34929351-34929373 CTGTAATCCCAGCTATTTGGGGG - Intronic
1081667721 11:44926355-44926377 CAGGAAGTCCAAATATTTATGGG + Intronic
1083434855 11:62635304-62635326 CTGTAATCCCAGCTATTTGGAGG - Intronic
1084160162 11:67344043-67344065 CTGTAATCCCAAATATTTGGGGG - Intronic
1084753991 11:71223055-71223077 GAGGGAGCTCAGAGATTTGGAGG + Intronic
1084886400 11:72210684-72210706 CTGTAATCCCAGCTATTTGGAGG + Intergenic
1085354075 11:75819844-75819866 CTGTAATCCCAGCTATTTGGAGG + Intronic
1086996153 11:93358703-93358725 CTGTAATCCCAGCTATTTGGAGG - Intronic
1088764800 11:112963707-112963729 AATGGAGCCCGGATATTTGGTGG + Intronic
1088775065 11:113074752-113074774 CTGTAATCCCAGCTATTTGGGGG - Intronic
1090594160 11:128303136-128303158 CAGTAAGGCCAAATATATGGTGG - Intergenic
1092226604 12:6752373-6752395 ATGGAAGCTCAGATACTTGGAGG + Intronic
1092293098 12:7176474-7176496 CAGGAAGCATGTATATTTGGTGG + Intergenic
1094824599 12:34260191-34260213 AATGAAGGCCAGATTTTTGGCGG + Intergenic
1097205508 12:57317532-57317554 CAGGAAGTCCAGAGATAGGGAGG - Intronic
1097790156 12:63806962-63806984 GTGGAAGCCCAGATTATTGGAGG - Intronic
1099121414 12:78694222-78694244 CAGGAAGCTCTGATATTTTGGGG + Intergenic
1099642580 12:85311266-85311288 CAGGCACACCAGATATTAGGAGG + Intergenic
1100419241 12:94414743-94414765 CAGGAAGAAAAAATATTTGGGGG + Intronic
1101139316 12:101778782-101778804 CTGTAATCCCAGCTATTTGGAGG + Intronic
1101198760 12:102412927-102412949 CCTGATGCCCACATATTTGGAGG - Intronic
1102239394 12:111314516-111314538 CTGTAATCCCAGCTATTTGGAGG + Intronic
1102934775 12:116887236-116887258 CAGGAAACACAGCTGTTTGGAGG - Intergenic
1104053413 12:125211428-125211450 CAGGAAGCCCACAGGGTTGGAGG - Intronic
1104436281 12:128759364-128759386 CAGTAATCCCAGCTATTTGGAGG - Intergenic
1104512479 12:129393050-129393072 CTAGAAGCTCAGATATTTAGAGG + Intronic
1104609846 12:130219168-130219190 CAGAAAGACCATAGATTTGGTGG + Intergenic
1104627802 12:130374032-130374054 AAGGAACCCCAGGGATTTGGTGG + Intergenic
1105251019 13:18698329-18698351 CTGGAAGCCCTGGGATTTGGGGG + Intergenic
1105301731 13:19141434-19141456 CTGTAGTCCCAGATATTTGGAGG + Intergenic
1105441546 13:20419413-20419435 CTGTAATCCCAGCTATTTGGAGG - Intronic
1106193438 13:27473914-27473936 CAGGAAGTGCAGATATGTTGGGG + Intergenic
1106195182 13:27487316-27487338 CTGTAATCCCAGATACTTGGGGG + Intergenic
1107362270 13:39632467-39632489 CACAAATCCCTGATATTTGGAGG + Intergenic
1108022042 13:46137412-46137434 CTGTAATCCCAGCTATTTGGTGG + Intronic
1108576214 13:51793890-51793912 CAGGAAGCTCAGATAACTTGTGG - Intronic
1109287966 13:60434343-60434365 CTGTAATCCCAGCTATTTGGGGG + Intronic
1110094225 13:71496108-71496130 CTGTAATCCCAGCTATTTGGAGG + Intronic
1110105974 13:71676473-71676495 CTGTAATCCCAGAAATTTGGGGG - Intronic
1111294266 13:86258784-86258806 CAGTAATCCCAGCTATTGGGAGG - Intergenic
1112675081 13:101691801-101691823 CAGGAAGCCGAGACATATTGAGG - Intronic
1116959420 14:50954722-50954744 CAAGTAGCCCAGATCTTAGGTGG + Intergenic
1117589429 14:57251289-57251311 CAGGGATCTCAGATATTTGGAGG - Intronic
1117695527 14:58358343-58358365 CTGTAATCCCAGATATTGGGAGG + Intronic
1118750347 14:68802962-68802984 CACAAATCCCTGATATTTGGAGG + Intergenic
1119153271 14:72385573-72385595 TATGAAGCCCAGGTATGTGGGGG + Intronic
1120185549 14:81390086-81390108 CCGTAATCCCAGCTATTTGGGGG + Intronic
1122003480 14:98683670-98683692 CAGGAAGCCCAACAATTGGGTGG + Intergenic
1122102338 14:99422972-99422994 CAGGAAGCTCAGTTACTTGAGGG + Intronic
1124036162 15:26055061-26055083 AAGGAAGTCCAGATGCTTGGGGG + Intergenic
1124338657 15:28876009-28876031 CACGATGCCCAGATATGAGGAGG - Intergenic
1125008395 15:34843385-34843407 CTGTAATCCCAGCTATTTGGTGG + Intergenic
1126059550 15:44766934-44766956 CTGTAATCCCAGCTATTTGGGGG + Intronic
1126592831 15:50356714-50356736 CAGTAAGTACAGATGTTTGGAGG + Intergenic
1127335337 15:57978911-57978933 CTGTAATCCCAGATACTTGGGGG + Intronic
1127460664 15:59195468-59195490 CAAGAAGCCCAGAGACTGGGAGG - Exonic
1128422093 15:67502688-67502710 TAGGAAACCGAAATATTTGGTGG + Intergenic
1129580044 15:76799383-76799405 CTGTAATCCCAGCTATTTGGGGG - Intronic
1131436619 15:92427859-92427881 CTGTAATCCCAGCTATTTGGAGG + Intronic
1132329035 15:100998199-100998221 AAGGAAGCCAAAATATCTGGTGG + Intronic
1132617903 16:851481-851503 CAGGGACCCCAGACGTTTGGGGG + Intergenic
1135088174 16:19491130-19491152 CTGCAAGCCCAGCTACTTGGGGG - Intronic
1135124479 16:19796954-19796976 CAGTAATCCCAGCTATTGGGAGG + Intronic
1135252570 16:20913432-20913454 CTGTAATCCCAGCTATTTGGAGG - Intronic
1135558216 16:23454601-23454623 TAGGAGTCCCAGTTATTTGGGGG + Intergenic
1136445998 16:30319403-30319425 CTGTAATCCCAGCTATTTGGGGG - Intergenic
1139942431 16:70615106-70615128 CCGTAAGTCCAGAGATTTGGGGG - Intronic
1140020773 16:71236569-71236591 CAGGAAGCCCAGCCATTTTCAGG - Intergenic
1140306478 16:73807577-73807599 CTGTAGGCCCAGCTATTTGGGGG - Intergenic
1140919825 16:79527225-79527247 CAGGCAGCACTGATATTTTGTGG - Intergenic
1142048596 16:87942766-87942788 CATGGTGCCCAGATATTTGGTGG + Intergenic
1142493585 17:293904-293926 CCGGAATCCCAGCTACTTGGTGG + Intronic
1143577342 17:7801981-7802003 CAGGAGTTCCAGGTATTTGGTGG - Exonic
1144537439 17:16104647-16104669 CAGTAATCCCAGCTATTGGGAGG + Intronic
1144823115 17:18089258-18089280 CTGTAATCCCAGCTATTTGGAGG - Intronic
1146219107 17:31002988-31003010 CTGTAATCCCAGCTATTTGGAGG + Intergenic
1146365237 17:32219383-32219405 CTGTAATCCCAGATCTTTGGGGG - Intronic
1147191854 17:38742527-38742549 CAGCAAGCCCAGAGACATGGCGG + Intronic
1149752852 17:59162848-59162870 CAGTAATCCCAGCTACTTGGAGG - Intronic
1149762803 17:59247751-59247773 CTGTAATCCCAGCTATTTGGGGG - Intronic
1149802236 17:59580666-59580688 CTTGAGTCCCAGATATTTGGAGG + Intronic
1149844254 17:59994823-59994845 CTTGAGTCCCAGATATTTGGAGG - Intergenic
1149893554 17:60411200-60411222 CTGTAATCCCAGCTATTTGGGGG + Intronic
1150054828 17:62005015-62005037 CTGTAATCCCAGATACTTGGAGG - Intronic
1150852262 17:68714921-68714943 CAGAAAGCCCAGATAGCTTGAGG + Intergenic
1153195338 18:2589622-2589644 CAAGAAGCCCTGAGTTTTGGAGG + Intronic
1154437831 18:14360585-14360607 CTGGAAGCCCTGGGATTTGGGGG - Intergenic
1155141209 18:23046349-23046371 CAGAAAGCACAGAAATTGGGGGG + Intergenic
1155822829 18:30399550-30399572 CAGGGTGCCCAGATATTTTAAGG + Intergenic
1156677267 18:39543005-39543027 GAGGAAGCACAGATGTTAGGAGG + Intergenic
1157482747 18:48066027-48066049 GAGGAAGCCCACCCATTTGGAGG + Intronic
1158035837 18:53029238-53029260 AAGGAAACACAGATATATGGGGG + Intronic
1158536188 18:58310110-58310132 CAGGAAGACCATCTATTTTGAGG - Intronic
1160091922 18:75835000-75835022 CTGGAAGCACAGTTATTTGTGGG + Intergenic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1160435112 18:78845647-78845669 CACAGATCCCAGATATTTGGAGG + Intergenic
1160489063 18:79321503-79321525 CTGTAATCCCAGCTATTTGGGGG - Intronic
1161847425 19:6719711-6719733 CTGGAAGTCCAGAGACTTGGAGG - Intronic
1162955088 19:14092941-14092963 CAGGAAGCCCAGATAATCAGAGG - Exonic
1163872511 19:19834141-19834163 CGGTAAGCCCAGAAATTTAGTGG + Intergenic
1163952929 19:20607515-20607537 AAGGAACCCCAGTTACTTGGAGG - Intronic
1164064435 19:21703500-21703522 CTGTAATCCCAGGTATTTGGAGG - Intergenic
1164858889 19:31546916-31546938 CAGTAATCCCAGCAATTTGGAGG + Intergenic
1166071011 19:40387956-40387978 CTGGAATCCCAGTTAGTTGGGGG - Intronic
1167320674 19:48795725-48795747 CAGAAAGCCCAGATAGTCAGAGG + Intronic
1168058283 19:53875724-53875746 CTGTAATCCCAGGTATTTGGGGG + Exonic
1168607852 19:57774092-57774114 CTGTAATCCCAGATATTCGGGGG + Intronic
925010329 2:480117-480139 CTTGATTCCCAGATATTTGGGGG - Intergenic
925284994 2:2709931-2709953 GAGGAAGCCCAGATGCTTGTCGG - Intergenic
925902326 2:8517486-8517508 CTGTAATCCCAGCTATTTGGGGG + Intergenic
927639348 2:24836906-24836928 CAGGATGCCCAGGTATGTGCAGG - Exonic
929064151 2:37956177-37956199 GTGAAAGCCCAAATATTTGGTGG - Intronic
929212021 2:39367646-39367668 CTGTAGTCCCAGATATTTGGGGG + Intronic
929492167 2:42406702-42406724 CTGTAATCCCAGATACTTGGGGG + Intronic
929860156 2:45669886-45669908 CAGTAATCCCAGCTATTTTGGGG + Intronic
930822127 2:55657345-55657367 CTGGAATTACAGATATTTGGGGG - Intronic
931283094 2:60810680-60810702 CAGGAGGCACAGATCGTTGGGGG - Intergenic
931721909 2:65072728-65072750 CAGGATCCCCAGATCCTTGGAGG - Exonic
932454086 2:71835091-71835113 CAGGAACCCCAGCTTTGTGGGGG - Intergenic
932628678 2:73319705-73319727 TAGGCATCCCAGATATATGGTGG + Intergenic
933188699 2:79308301-79308323 CTGTAATCCCAGAAATTTGGGGG - Intronic
933260946 2:80130821-80130843 CATGAAGCCCAGATAAATAGGGG + Intronic
934713563 2:96530571-96530593 CTGGAAGCCCAGGCTTTTGGGGG - Intergenic
935116139 2:100138131-100138153 CAGGAAGGGAAGATAGTTGGTGG - Intronic
936094622 2:109522417-109522439 CTGTAATCCCAGATACTTGGGGG - Intergenic
936860851 2:117018705-117018727 AAGGAAGCTGAGATATTTGGGGG + Intergenic
938416560 2:131107783-131107805 CTGTAATCCCAGCTATTTGGGGG - Intronic
939631657 2:144533320-144533342 CAGGAAGGCCAGTTAGGTGGCGG - Intergenic
939878914 2:147608021-147608043 TATGAAGCCCAGATTTTTGAAGG + Intergenic
940210004 2:151246546-151246568 CAGGATCCCCAGGTTTTTGGGGG + Intergenic
941849992 2:170170730-170170752 CAGTAAGCCCTGATATTAGCAGG - Intergenic
942599022 2:177621136-177621158 TAGGGATCCCAGAAATTTGGAGG - Intergenic
944787332 2:203086655-203086677 CTGTAATCCCAGCTATTTGGGGG - Intronic
944873118 2:203933945-203933967 GGTGAAGCCTAGATATTTGGGGG + Intergenic
944886363 2:204066440-204066462 CAGGAAGCAGAGATCCTTGGGGG - Intergenic
945186127 2:207141613-207141635 AAGGAAGCCCAAATCTTTTGGGG + Intronic
945746262 2:213722855-213722877 CAGGAAACTCAGTTGTTTGGGGG + Intronic
945983975 2:216339897-216339919 CAGGAGGCCCAGAGAGATGGTGG - Intronic
946481992 2:220066188-220066210 CAGGCAGCCCAAAAATTGGGGGG - Intergenic
947442949 2:230139382-230139404 CTGTAAGCCCAGCTACTTGGGGG - Intergenic
947526440 2:230879367-230879389 CAGGATGCCCAGCTCTTTAGGGG - Intergenic
948219190 2:236255881-236255903 AAGGAAGCCCAGATAAAGGGAGG - Intronic
1168771437 20:419338-419360 CTTGAAGCCCAGATCTGTGGAGG - Exonic
1168960197 20:1863849-1863871 CAGGAAGCACTGATATGGGGAGG + Intergenic
1169508388 20:6238375-6238397 CAGAAAGCTCAGATATTTGTGGG + Intergenic
1169984986 20:11434107-11434129 CTGTAATCCCAGCTATTTGGGGG + Intergenic
1172533829 20:35654826-35654848 AAGGAAGCCCCCATATTTGGAGG + Exonic
1174447856 20:50602435-50602457 CAGGAAGCCCACATCTGAGGTGG + Exonic
1174641357 20:52047248-52047270 CTGGAATCCCAGCTATTGGGAGG - Intergenic
1174905568 20:54546868-54546890 CAGGGAGACCAGACATTTGGTGG + Intronic
1175178639 20:57129255-57129277 CAAGAAGACCAGAAATCTGGTGG - Intergenic
1176262644 20:64190549-64190571 CTGTAATCCCAGCTATTTGGGGG + Intronic
1176421170 21:6517018-6517040 CAGGAACCTCAAATATTTTGGGG + Intergenic
1177038010 21:16069556-16069578 CAGGAAGAGAAGATGTTTGGGGG - Intergenic
1178878175 21:36428508-36428530 CTGTAATCCCAGCTATTTGGGGG - Intergenic
1179663970 21:42896936-42896958 CAGGAAGCCCAGGTGTTTCGAGG + Exonic
1179696660 21:43125335-43125357 CAGGAACCTCAAATATTTTGGGG + Intergenic
1179996719 21:44977616-44977638 CTGGAAGCCCTGGGATTTGGGGG + Intergenic
1182710369 22:32318903-32318925 CAGGGTGCCCTGATATTTGGTGG + Intergenic
1183526968 22:38328827-38328849 TAGGAACCTCGGATATTTGGGGG + Intronic
1183538249 22:38415524-38415546 CAGGCAGCCCAGGGGTTTGGTGG + Intergenic
1184285095 22:43465990-43466012 CAGGCAGCCTTGATTTTTGGGGG + Intronic
1184348149 22:43925487-43925509 AAGGAAGCCCAGATAAAAGGGGG - Intronic
1184910438 22:47528808-47528830 CAGAAATCTTAGATATTTGGGGG - Intergenic
1185322280 22:50207244-50207266 CTGTAACCCCAGCTATTTGGGGG - Intronic
949112707 3:281680-281702 CTGTAATCCCAGCTATTTGGGGG - Intronic
949763478 3:7499189-7499211 AAAGAAGCCCAGAGATTTTGAGG - Intronic
950089485 3:10285367-10285389 CAGGAAGCCCTGATGTTTAAAGG + Intronic
950089608 3:10286270-10286292 CAGGAAGCTCTAATATTTGAAGG + Intronic
950492589 3:13314970-13314992 CAGGAAGCCCAGGTAGCTGCAGG - Intergenic
951892576 3:27580863-27580885 CTGTAATCCCAGCTATTTGGGGG + Intergenic
953617864 3:44508154-44508176 CTGTAATCCCAGCTATTTGGGGG + Intronic
954090571 3:48280508-48280530 CTGTAATCCCAGATACTTGGAGG + Intronic
954243409 3:49311824-49311846 CAGGAAGACCAGTTAATTTGTGG - Intronic
954308671 3:49747347-49747369 CTGGAAGTCCTGATATTTGAAGG - Intronic
954562933 3:51573556-51573578 CTGTAATCCCAGCTATTTGGAGG - Intronic
954696491 3:52430055-52430077 CATGAAGCCCAGATTGATGGAGG - Intergenic
955827285 3:62961979-62962001 CAGGTAGCCCAGAGCTGTGGTGG + Intergenic
955986460 3:64578683-64578705 CAGGAAGAACAGATTTGTGGAGG - Intronic
956225405 3:66951931-66951953 CAGTAATCCCAGAAACTTGGAGG - Intergenic
956360666 3:68443302-68443324 AAGTAGGCACAGATATTTGGTGG - Intronic
956641109 3:71416420-71416442 CTGTAATCCCAGCTATTTGGGGG + Intronic
957211206 3:77260965-77260987 CAGGAAGCCCAGCTACCAGGAGG - Intronic
957584959 3:82121209-82121231 CAGGGAGGTCACATATTTGGAGG + Intergenic
957715000 3:83916386-83916408 GAGGAGGAACAGATATTTGGAGG + Intergenic
957885980 3:86288174-86288196 AAGGAAGCCTAAATATTTGGTGG - Intergenic
961106822 3:124249679-124249701 CAGGAAGCTCACATATAGGGTGG - Intronic
961196759 3:125008673-125008695 CTGTAATCCCAGCTATTTGGAGG + Intronic
961545014 3:127627193-127627215 CTGGAATCCCAGCTACTTGGGGG - Intergenic
962694935 3:137938663-137938685 CACGAATCGAAGATATTTGGGGG + Intergenic
963986156 3:151597404-151597426 GAGGAAGCCCAGAGAGCTGGAGG + Intergenic
964598196 3:158462111-158462133 CATAAAGCCAGGATATTTGGGGG - Intronic
964611386 3:158620150-158620172 CAGTAATCCCAGCTATTTGGGGG - Intergenic
964777640 3:160295483-160295505 CCTGTAGCCCAGATACTTGGAGG + Intronic
965300437 3:167000071-167000093 CTGAAAGCACAGAGATTTGGGGG - Intergenic
965414310 3:168373282-168373304 CAGTAATCCCAGCTAATTGGAGG + Intergenic
967299700 3:188000699-188000721 CAGGAAGCCCACAGCTGTGGTGG + Intergenic
967881493 3:194304981-194305003 AAGGAAGCCCTGAGATTTGATGG - Intergenic
968133336 3:196205780-196205802 CTGTAATCCCAGCTATTTGGAGG - Intronic
968688265 4:1975925-1975947 CAGGAAGGACAGAGATTTGGGGG + Intronic
969967425 4:11011638-11011660 CTGTAATCCCAGCTATTTGGAGG + Intergenic
970293758 4:14605539-14605561 CAGGAAGCCCAGTACCTTGGTGG + Intergenic
970936174 4:21572747-21572769 CTGTAATCCCAGATACTTGGGGG - Intronic
971780608 4:31029464-31029486 CATGAAAACCAGATATTTGCAGG + Intronic
971819526 4:31533368-31533390 CATAAAGCCCAGATGTTTGTGGG - Intergenic
972252458 4:37318145-37318167 CTGTAATCCCAGCTATTTGGAGG - Intronic
972506237 4:39722916-39722938 CTGTAATCCCAGATACTTGGGGG - Intronic
973262555 4:48179509-48179531 CTGGAATCCCAGCTACTTGGGGG - Intronic
974139278 4:57863867-57863889 CAGAAAGCTAAAATATTTGGAGG + Intergenic
975325797 4:73057302-73057324 CTGCAATCCCAGATACTTGGAGG + Exonic
975437678 4:74372446-74372468 CAGGAAGCCTGGATATTTAATGG - Intronic
975754299 4:77557691-77557713 CAGTAAGCCCAGGTCTTTAGTGG + Intronic
976903826 4:90211246-90211268 CTGCAAGCCCAGAAATTTGTGGG + Intronic
977405408 4:96591423-96591445 TAGGAAGCACAGCTATTTGTAGG - Intergenic
978444757 4:108769856-108769878 CAGTAGTCCCAGCTATTTGGGGG - Intergenic
979186792 4:117806520-117806542 CAATAAGGTCAGATATTTGGGGG - Intergenic
980367504 4:131823449-131823471 CTATAATCCCAGATATTTGGAGG + Intergenic
980872823 4:138629419-138629441 CAGGAAGCCTAGATGATAGGAGG + Intergenic
982255588 4:153448369-153448391 CATGAAGCCCAGATGTATGAGGG - Intergenic
982752465 4:159178678-159178700 CTGTAAGCCCAGCTACTTGGGGG - Intronic
982823701 4:159976472-159976494 CTGGAAGCCCAGATATTGAAGGG + Intergenic
983773581 4:171578706-171578728 CAAAAAGCCCAGATAACTGGTGG + Intergenic
985165680 4:187091373-187091395 TAGAAAACCCAAATATTTGGAGG - Intergenic
986949680 5:13068233-13068255 CACCATGCCCAGCTATTTGGTGG - Intergenic
989466701 5:41764931-41764953 CAGAAAAACCAGATATTTGAAGG - Intronic
995382321 5:111548885-111548907 AAGGAGGCCCAGTGATTTGGGGG + Intergenic
995660430 5:114476539-114476561 CTGTAATCCCAGCTATTTGGGGG - Intronic
996406288 5:123107804-123107826 CAGGAAGTCCAGTGGTTTGGTGG + Intronic
997103025 5:130989392-130989414 CTGAAAGCACAGATTTTTGGGGG + Intergenic
997801386 5:136866047-136866069 CAGGAAGTCAAGGGATTTGGAGG + Intergenic
997990046 5:138537131-138537153 CAGGCAGCCTACATACTTGGAGG + Intronic
998728615 5:145047755-145047777 CTGTAAGCCCAGCTACTTGGGGG + Intergenic
998928758 5:147157130-147157152 GAGGAAGCCCAGCTGTTTGAGGG + Intergenic
1001484248 5:172108491-172108513 CTGTAATCCCAGATACTTGGGGG + Intronic
1001632013 5:173182461-173182483 TAGGAAGACCAGAGATTTGATGG - Intergenic
1002060636 5:176623745-176623767 CTGTAATCCCAGATACTTGGAGG + Intronic
1002710558 5:181192290-181192312 CAGGAGGGCCAGGTGTTTGGAGG + Intergenic
1003618310 6:7674792-7674814 CTGTAATCCCAGCTATTTGGGGG - Intergenic
1004068824 6:12277848-12277870 CTGGAAGCCCTGAGATTTGCTGG + Intergenic
1005576946 6:27198582-27198604 CTGTAATCCCAGATACTTGGGGG + Intergenic
1006395669 6:33785800-33785822 TGGGAAGCAAAGATATTTGGTGG + Intronic
1007332629 6:41125230-41125252 CTGTAAACCCAGATACTTGGGGG + Intergenic
1010991975 6:82489746-82489768 CAGCATGCCCAGATAACTGGTGG - Intergenic
1011636792 6:89382108-89382130 CAGAAAGCCAATATAATTGGGGG + Intronic
1012863889 6:104595127-104595149 CTGCAGGCCCAGCTATTTGGTGG + Intergenic
1012951346 6:105521362-105521384 CAGGGAGTCCAAATATATGGAGG - Intergenic
1013256019 6:108386336-108386358 CTGTAATCCCAGCTATTTGGGGG + Intronic
1014846734 6:126287010-126287032 TAGGAAGCCTAGACATTTGGTGG - Intergenic
1015547018 6:134371543-134371565 CAGGTAGACATGATATTTGGGGG + Intergenic
1015963617 6:138675655-138675677 CTGTAATCCCAGCTATTTGGGGG - Intronic
1016570109 6:145502438-145502460 CAGGAAAGTCATATATTTGGGGG - Intronic
1018413997 6:163585611-163585633 CTGTAATCCCAGCTATTTGGGGG - Intergenic
1018464538 6:164031755-164031777 CAGGAACACCTGAGATTTGGTGG - Intergenic
1019812619 7:3175602-3175624 GAGGCTGCCCAGATAATTGGAGG + Intergenic
1020956437 7:14745105-14745127 CAGCATGCCCAGATAACTGGTGG - Intronic
1021625346 7:22587600-22587622 CAGGAAGCCCAGATGCTGTGTGG - Intronic
1021968230 7:25943153-25943175 CAGGAAGCCCAGAGGTAAGGAGG - Intergenic
1022561200 7:31351701-31351723 GAGGCAGCACATATATTTGGTGG + Intergenic
1022699943 7:32750316-32750338 CTGTAATCCCAGCTATTTGGAGG + Intergenic
1022735213 7:33069841-33069863 CTGTAATCCCAGATACTTGGGGG - Intergenic
1023315470 7:38931742-38931764 CAAGAATCCCAGCTAATTGGGGG - Intronic
1023580210 7:41673570-41673592 CAGGAAGCCAATATCTGTGGAGG + Intergenic
1023631379 7:42167458-42167480 AAGGAGGGCCAGATATTTGCTGG - Intronic
1024529334 7:50378108-50378130 CAGGAAATGCAGATATTTGTGGG + Intronic
1026297049 7:69062196-69062218 CAGGCTGCCCAGATATTTGGTGG - Intergenic
1026567529 7:71501776-71501798 AAGGAAGGACAGATGTTTGGGGG - Intronic
1026728886 7:72894139-72894161 CTGTAGTCCCAGATATTTGGAGG + Intronic
1027494105 7:78866286-78866308 AAGGAAGTCCAGATATGGGGAGG + Intronic
1027680954 7:81221516-81221538 CATGAAGTACAGATATTGGGGGG - Intergenic
1029417936 7:100455198-100455220 CAGGAAGCCCTGAGATTTAATGG - Intergenic
1030174391 7:106636258-106636280 CTGTAAGCCCAGCTACTTGGGGG + Intergenic
1032356388 7:131215169-131215191 CTGTAATCCCAGCTATTTGGTGG - Intronic
1034721303 7:153295868-153295890 CAGGAAGACAAGGGATTTGGAGG + Intergenic
1037533966 8:19807819-19807841 CAGGAAGCCCAATTCTATGGCGG - Intergenic
1038550148 8:28460545-28460567 CTGTAATCCCAGCTATTTGGCGG - Intronic
1038692072 8:29773064-29773086 CAAGAAGCCCAGACTTTGGGAGG + Intergenic
1039460402 8:37738760-37738782 CTGTAATCCCAGTTATTTGGGGG + Intronic
1039483512 8:37893377-37893399 CAGGAAGCCCAGAGCCTTGTAGG - Intronic
1040008031 8:42637205-42637227 CCGTAATCCCAGAAATTTGGGGG + Intergenic
1041072812 8:54141972-54141994 CAGTAATCCCAGCTATTTCGAGG - Intronic
1041614665 8:59892541-59892563 CTGTAATCCCAGCTATTTGGAGG - Intergenic
1042492819 8:69420168-69420190 CAAGAAGTTCAGAGATTTGGTGG - Intergenic
1043520324 8:81038206-81038228 CAGGAAGCCGAGAAAGTTGTGGG + Intronic
1044108415 8:88240248-88240270 CATGGTACCCAGATATTTGGAGG + Intronic
1045031834 8:98144396-98144418 CTGTAATCCCAGCTATTTGGGGG - Intronic
1046032887 8:108804645-108804667 CTGTAAGCCCAGCTACTTGGGGG - Intergenic
1046795330 8:118365288-118365310 AGGGATGCCCAGATAGTTGGTGG + Intronic
1047214144 8:122863301-122863323 CACAAAGCCCAGAGATTTTGAGG + Intronic
1048686184 8:136907599-136907621 CAGAATGCCCAGATAACTGGTGG + Intergenic
1048832556 8:138490883-138490905 CTGTAATCCCAGAAATTTGGGGG + Intronic
1049176154 8:141193918-141193940 CAGGAAGGACATAGATTTGGAGG + Intronic
1049433233 8:142574866-142574888 CAGGAAGCCCCTCTATTTGTGGG + Intergenic
1050210617 9:3251590-3251612 CTGTAATCCCAGCTATTTGGGGG - Intronic
1051400642 9:16678388-16678410 CTGTAATCCCAGCTATTTGGAGG - Intronic
1052812072 9:33070001-33070023 CAGTAATCCCAGCTACTTGGTGG + Intronic
1054762072 9:69012870-69012892 CAGGAAGCCCAGATATTTGGAGG - Exonic
1055725556 9:79224467-79224489 CAGGAGGGTCAGATATTTGAGGG - Intergenic
1056315313 9:85383024-85383046 CAGGAAGTGGAGACATTTGGAGG - Intergenic
1057180608 9:93027840-93027862 CTGTAGTCCCAGATATTTGGGGG - Intronic
1058114678 9:101071306-101071328 GAGGAAGAACAGATATTTGGAGG + Intronic
1059610229 9:115884454-115884476 CAAGAAGCCAACAAATTTGGGGG + Intergenic
1060944431 9:127561608-127561630 CAGGGAGCCCAGAGGTTTTGGGG - Intronic
1061276965 9:129574536-129574558 CAGTAATCCCAGCTACTTGGGGG - Intergenic
1062418625 9:136467231-136467253 CAGGAAGCCATGAGATCTGGAGG + Intronic
1185461768 X:336043-336065 CTGGAAGCCCAGCTACTCGGGGG + Intronic
1186079624 X:5916570-5916592 CTGTAATCCCAGCTATTTGGTGG - Intronic
1187166686 X:16810936-16810958 CTGGAAACCCAGCAATTTGGGGG - Intronic
1188781354 X:34289959-34289981 CTGTAATCCCAGAAATTTGGGGG + Intergenic
1189819014 X:44852220-44852242 CTGTAATCCCAGCTATTTGGGGG - Intergenic
1190221468 X:48514986-48515008 CAGGGAGCGCAGATATATGGGGG + Intronic
1192081299 X:68050351-68050373 CTGGAAGCCCAGACATAGGGTGG + Intronic
1192786404 X:74340354-74340376 CATGAATCCCTGATATTTGGAGG + Intergenic
1193476745 X:81975504-81975526 CAGTAAGCCAATATATTTGAAGG + Intergenic
1195798523 X:108680740-108680762 CAGGATTCCCAGGTATTTGAAGG + Exonic
1201748091 Y:17402641-17402663 AAGGAGGCCCAGAAATTTGTTGG + Intergenic
1201899031 Y:19027661-19027683 CAGTAATCCCAGCTACTTGGGGG + Intergenic
1202160976 Y:21936544-21936566 CAGTAAGTCCAGAGATTTTGTGG - Intergenic
1202230380 Y:22649829-22649851 CAGTAAGTCCAGAGATTTTGTGG + Intergenic
1202312777 Y:23546336-23546358 CAGTAAGTCCAGAGATTTTGTGG - Intergenic
1202558025 Y:26124258-26124280 CAGTAAGTCCAGAGATTTTGTGG + Intergenic