ID: 1054762527

View in Genome Browser
Species Human (GRCh38)
Location 9:69015776-69015798
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054762527_1054762528 -7 Left 1054762527 9:69015776-69015798 CCTTTAAGTTTGACAGCTAATTC No data
Right 1054762528 9:69015792-69015814 CTAATTCTGCCTACCCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054762527 Original CRISPR GAATTAGCTGTCAAACTTAA AGG (reversed) Intergenic
No off target data available for this crispr