ID: 1054763103

View in Genome Browser
Species Human (GRCh38)
Location 9:69020998-69021020
Sequence GCTCAACAAACAATGATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054763101_1054763103 -8 Left 1054763101 9:69020983-69021005 CCTGGAACTGTGGACGCTCAACA No data
Right 1054763103 9:69020998-69021020 GCTCAACAAACAATGATGGATGG No data
1054763097_1054763103 18 Left 1054763097 9:69020957-69020979 CCACTATATCATCAGCAACCACA No data
Right 1054763103 9:69020998-69021020 GCTCAACAAACAATGATGGATGG No data
1054763100_1054763103 0 Left 1054763100 9:69020975-69020997 CCACAGTGCCTGGAACTGTGGAC No data
Right 1054763103 9:69020998-69021020 GCTCAACAAACAATGATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054763103 Original CRISPR GCTCAACAAACAATGATGGA TGG Intergenic
No off target data available for this crispr